![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
|
|
|
|
|
||
|
Published online before print
August 23, 2007, 10.1101/gr.6553207 Genome Res. 17:1448-1457, 2007 ©2007 by Cold Spring Harbor Laboratory Press; ISSN 1088-9051/07 $5.00
Letter A novel olfactory receptor gene family in teleost fishInstitute of Genetics, University of Cologne, D-50674 Cologne, Germany
While for two of three mammalian olfactory receptor families (OR and V2R) ortholog teleost families have been identified, the third family (V1R) has been thought to be represented by a single, closely linked gene pair. We identified four further V1R-like genes in every teleost species analyzed (Danio rerio, Gasterosteus aculeatus, Oryzias latipes, Tetraodon nigroviridis, Takifugu rubripes). In the phylogenetic analysis these ora genes (olfactory receptor class A-related) form a single clade, which includes the entire mammalian V1R superfamily. Homologies are much lower in paralogs than in orthologs, indicating that all six family members are evolutionarily much older than the speciation events in the teleost lineage analyzed here. These ora genes are under strong negative selection, as evidenced by very small dN/dS values in comparisons between orthologs. A pairwise configuration in the phylogenetic tree suggests the existence of three ancestral Ora subclades, one of which has been lost in amphibia, and a further one in mammals. Unexpectedly, two ora genes exhibit a highly conserved multi-exonic structure and four ora genes are organized in closely linked gene pairs across all fish species studied. All ora genes are expressed specifically in the olfactory epithelium of zebrafish, in sparse cells within the sensory surface, consistent with the expectation for olfactory receptors. The ora gene repertoire is highly conserved across teleosts, in striking contrast to the frequent species-specific expansions observed in tetrapod, especially mammalian V1Rs, possibly reflecting a major shift in gene regulation as well as gene function upon the transition to tetrapods.
The olfactory sense is one of the main tools that animals developed to make sense of their environment. Thousands of structurally diverse odor molecules perceived and discriminated by vertebrates supply them with a wide range of vital information, ranging from prey and predator localization to mating behavior.
In mammals odor molecules are detected by three olfactory receptor families that are expressed in olfactory sensory neurons: olfactory receptors (ORs), with
While several studies classified the V2R and OR receptors as evolutionary old families, with
Five novel V1R-like genes were identified in each of five teleost species A recursive search strategy starting with all known V1R genes and using automatic ortholog annotation in combination with the TBLASTN algorithm (for details, see Methods) uncovered five novel genes in the zebrafish genome (Fig. 1). All orthologs of all five Danio rerio genes could be identified in four further fish species, Gasterosteus aculeatus, Oryzias latipes, Takifugu rubripes, and Tetraodon nigroviridis (three-spined stickleback, medaka, and two pufferfish, respectively). No pseudogenes were detected in any of the five teleost species. We propose to name these V1R-like genes ora (olfactory receptors related to class A, cf. Schiöth and Fredriksson 2005  ; www.gpcr.org/), not V1Rs, since that name refers to the vomeronasal system which fish do not possess—all the fish olfactory receptors are expressed in the main olfactory epithelium. The designation "ora" reflects both the olfactory-specific nature of these receptors as well as their phylogenetic position within the GPCR superfamily. Individual ora genes were numbered from 1 to 6, beginning with the first zebrafish ora gene to be identified (Pfister and Rodriguez 2005). The new nomenclature is shown in Supplemental Table 1. It mirrors the recent renaming of the fish V2R-like genes as OlfC genes (cf. Alioto and Ngai 2006). In the phylogenetic comparison with other teleost chemosensory receptor families (see below) ora genes emerge as a monophyletic group.
The ora genes form a single clade together with mammalian V1Rs Using the T2Rs as an outgroup we compared the newly found genes to the most closely related chemosensory receptor families, the mammalian V1R genes (Fig. 1A). With respect to T2R, OR (Supplemental Fig. 1), and other chemosensory receptor gene families (T1R, OlfC; data not shown), all fish ora genes form a monophyletic clade, supporting their identification as a single family separate from the other chemosensory receptor families. The Ora clade includes all mammalian V1R receptors (Fig. 1A; Supplemental Fig. 1); thus, the Ora family can be considered paraphyletic, with the mammalian V1Rs originating as a single subclade within the Ora family. Both mammalian and fish taste receptors of the T2R family (Ishimaru et al. 2005 ) are phylogenetic neighbors, but nevertheless clearly segregate from the Ora family with high bootstrap values (Fig. 1A). Odorant receptor genes (ORs) are even more distant from the ora genes (Supplemental Fig. 1). The six ora genes subdivide into three pairs, ora1–ora2, ora3–ora4, and ora5–ora6. In the phylogenetic tree these subclades are supported by maximal bootstrap values (Fig. 1B). Orthologs of the individual genes in all cases can be identified unambiguously, again with maximal bootstrap values (Fig. 1A). Conserved amino acids commonly are restricted to the orthologs of a single gene, but often a particular position is conserved in all orthologs of a gene pair (cf. Fig. 2 and Supplemental Fig. 2), consistent with the branchpoint pattern of the phylogenetic tree. Motifs conserved across two or all three gene pairs are comparatively rare, as detailed below.
Low overall similarity but high degree of conservation of motifs that are characteristic for mammalian V1Rs The ora genes constitute a highly heterogeneous family, with homologies often as low as 15% and minimally 11% (Supplemental Table 2). We, therefore, analyzed the retention of characteristic sequence motifs in order to obtain a second line of evidence supporting the identification of ora genes both as a new family and as a V1R-related family.
Mammalian V1Rs are already quite divergent and comprise, e.g., in mice twelve distantly related subfamilies (Rodriguez et al. 2002
Beyond these motifs ora genes contain some general class A GPCR-specific motifs and 13 conserved amino acids, which are—with two exceptions—not conserved in either fish OR or T2R genes (Ishimaru et al. 2005
ora genes precede teleost speciation
The clear separation in three subclades (Fig. 1) suggests the presence of three ancestral genes, of which the corresponding phylogenetic level(s) remain to be elucidated.
Gene loss and gene gain upon transition to tetrapods We hypothesize that the partial gene loss might be due to the loss of a fully aquatic lifestyle in amphibians, and that the gene expansion is related to the transition to a terrestrial environment, consistent with a major shift in function of ora genes during this transition.
Strong negative selection for ora genes, but no evidence for positive selection Paralog homology is usually below 25% amino acid identity and often as low as 15%, with average values for each species close to 20% (Fig. 3B; Supplemental Table 2). Most of this divergence is due to radical amino acid changes, since average similarity of paralogs is still <40% for all species (Fig. 3C). Homology within paralog gene pairs is somewhat higher than between them, with ora5 vs. ora6 comparisons always resulting in lower values than those obtained for the other two gene pairs, ora1 vs. ora2 and ora3 vs. ora4. Ortholog homologies are much higher and in fact identity of any ortholog pair is higher than that of any paralog pair in all possible pairwise comparisons bar one (Supplemental Table 1). The average identity in all ortholog comparisons is 60%, with mean values for the individual ora genes ranging between 46% and 72%, and average ortholog similarities go up from 60% to 81%, with an average value for all ora genes of 72% (Fig. 3).
These values appear large enough (cf. Wolfe and Sharp 1993
To avoid distortion of the dN/dS ratio by beginning saturation of synonymous substitutions (Gojobori 1983
We observe a very low average dN/dS ratio for comparisons between orthologs (0.25), with values for individual genes ranging between 0.11 (ora1) and 0.37 (ora6) (Fig. 3A). All values clearly indicate strong negative selection, i.e., the ora genes are slowly evolving genes. A low dN/dS value of the ora genes together with a high divergence between ora genes indicates a very ancient origin of this slowly evolving gene family. This is drastically different from the properties of the mammalian V1R family, which is characterized by fast evolution and consequently highly species-specific gene repertoires. Incidentally, this difference in evolution rates may be related to the difference in pseudogene frequency: High numbers of pseudogenes are present in the V1R family (Zhang et al. 2004 Since overall strong negative selection could mask positive selection at a few individual codon sites, we also analyzed the dN/dS ratio for each sequence position, using a manually optimized alignment of all orthologs for a particular ora gene. This analysis was performed separately for ora1, ora2, and ora4, the genes with the highest ortholog homologies. As expected from the summary dN/dS analysis, extended regions of the coding sequence show evidence for moderate to strong negative selection (Fig. 4). Moreover, no evidence for any positively selected site was found in any of these genes. A comparison between ora1, ora2, and ora4 shows rough similarity in the pattern of negative selection, although no specific motifs could be identified between genes (Fig. 4).
Multiexonic structure of some ora genes is highly conserved between species It is generally believed that all mammalian V1R genes possess a single exon structure (Dulac and Axel 1995 ; Saito et al. 1998; Rodriguez et al. 1999; Del Punta et al. 2000; Grus et al. 2005). It came, therefore, as quite a surprise that about half of the fish ora genes show a multi-exon structure in the coding region with two, three, or four exons (Fig. 5). A few introns occur only in one species: Tnora2 and Drora4 exhibit one additional intron, and Trora6 even two, compared to the exon structure in the remaining four species (Fig. 5). These isolated findings are best explained by late events in evolution, after teleost speciation. The ancestral genomic structure thus appears to be monoexonic for ora1, ora2, ora5, and ora6. This structure is maintained in the mammalian relatives of the Ora1–Ora2 clade (Dulac and Axel 1995; Grus et al. 2005).
In marked contrast, ora4 possesses two exons in four fish species (three in Danio rerio), and in all cases a small N-terminal exon is followed by a several-fold larger C-terminal exon. For ora3 four approximately equal-sized exons are predicted in all five fish species examined (Fig. 5). For the zebrafish representatives these exon predictions have been confirmed by sequencing all products of the RT-PCR analysis (Fig. 7A, see below; Supplemental Fig. 3). ora3 intron/exon borders are exactly conserved between all five teleost species, and the same holds true for ora4 (Supplemental Fig. 2). The sole intron/exon border in ora4 does not correspond to any intron/exon border in ora3. The striking conservation of particular intron/exon structures could indicate a role of noncoding elements in regulation of ora gene expression.
Four ora genes are arranged in closely linked gene pairs in head-to-head and tail-to-tail orientation
Specific expression of all ora genes in the olfactory epithelium Any olfactory receptor is expected to be specifically expressed in olfactory receptor neurons situated in the olfactory epithelium. To test that prediction, we performed RT-PCR with seven different tissues and all zebrafish ora genes. All six genes were expressed specifically in the olfactory epithelium (Fig. 7A), supporting their assignment as olfactory receptors. None of the genes was expressed in the taste cell-containing tissues barbels and lips (Fig. 7A), confirming the segregation of the ora gene family from its closest phylogenetic neighbors, the T2R family of taste receptor genes. To analyze the expression of ora genes at the cellular level we performed in situ hybridization for all six ora genes. All ora genes are expressed in sparse cells confined to the sensory region of the zebrafish olfactory epithelium (Fig. 7B,C), consistent with their expression in olfactory receptor neurons.
We have identified a novel olfactory receptor gene family in teleost fish, which we named ora for olfactory receptor genes related to class A GPCRs. The homologous mammalian V1R genes have not been formally assigned to any of the five major GPCR classes yet, but are most related to the class A or rhodopsin family of GPCRs (Schiöth and Fredriksson 2005 ; this study). All mammalian V1R genes belong to one of three clades within the Ora family. Previously a single V1R-related gene had been described in several teleost species (Pfister and Rodriguez 2005). The genes reported there correspond to ora1 (zebrafish) and ora2 (pufferfishes and medaka). The latest search for teleost V1R-related genes (Shi and Zhang 2007) yielded further orthologs of ora1 (medaka) and ora2 (zebrafish). ora3–ora6 presumably have been overlooked so far due to the low sequence identity between paralogs and their peculiar gene structure.
The specific expression of all Ora family members in the olfactory epithelium, and indeed in olfactory receptor neurons, as well as the relationship to mammalian V1R receptors support the identification of this novel family as olfactory receptors. Among olfactory receptor families the Ora family is unique for its small, rigidly maintained gene repertoire (no pseudogenes, no gene gains in five teleost species, only one gene loss in pufferfish), as well as the strict genomic arrangement in symmetrical gene pairs (for four of the six genes). Accordingly, we found extensive negative selection in the ora genes, but no evidence for positive selection, in striking contrast to the situation in the mammalian V1R family (Grus et al. 2005
The evolutionary origin of the Ora family is not completely resolved. The presence of all six ora genes in zebrafish (an Ostariophysi, i.e., a rather primitive teleost) as well as in two more modern fish species (stickleback and medaka, both Neoteleostei) indicates their presence at least in Otocephala, while the existence of ora1, ora1–ora2, and ora3–ora4 orthologs in Xenopus would seem to suggest that the most recent common ancestor (MRCA) of tetrapods and teleosts already possessed the ora1–ora2 gene pair and at least one gene from the Ora3–Ora4 clade. Since in the phylogenetic analysis the Ora5–Ora6 clade appears to be at least as ancient as the other two clades, it may have been already present in the MRCA. In fact, the Ora family appears to be much more ancient than the actinopterygian/sarcopterygian split leading to teleosts and tetrapods, respectively, since a member of the Ora3–Ora4 clade is present already in the genome of a jawless vertebrate, Petromyzon marinus (L.R. Saraiva and S.I. Korsching, unpubl.). The phylogenetic tree would support two ancient large scale genome duplications to generate the three clades observed here from a single ancestral gene. These duplications could correspond to the two whole genome duplications 590 and 440 million years ago (Meyer and Schartl 1999 The inverse orientation of the gene pair in the Ora1–Ora2 clade vs. the Ora3–Ora4 clade supports an independent origin of these two local duplication events. Thus the genesis of the three clades most likely preceded the genesis of the ora gene pairs, consistent with the phylogenetic tree. Whether the MRCA already contained both genes of the ora3–ora4 and the ora5–ora6 gene pairs cannot be decided with current data. Further evolutionary analysis with more ancestral species will be necessary to unequivocally resolve these issues.
In Xenopus the first example for the species-specific expansion of subfamilies so common in mammalian V1Rs (Grus et al. 2005
The genomic arrangement of the ora genes presented two unexpected findings. In contrast to all mammalian V1R genes several instances of multiexonic organization are found for the ora genes. A few occur only in one species and these isolated findings are best explained by late events in evolution, after teleost speciation. The ancestral genomic structure thus appears to be monoexonic for ora1, ora2, ora5, and ora6. This structure is maintained in the tetrapod relatives of the Ora1–Ora2 clade, the amphibian and mammalian genes (Saito et al. 1998 Interestingly, none of these four intron/exon borders are found in the monoexonic Xenopus Ora3–Ora4 clade member (Xtora15; data not shown) nor in the intronless Ora3–Ora4 clade member found in Petromyzon marinus (L.R. Saraiva and S.I. Korsching, unpubl.). The most parsimonious explanation for the absence, presence, and location of the different intron/exon borders in ora3 vs. ora4 is an independent gain of introns posterior to the genesis of the ora3–ora4 gene pair, but prior to the teleost speciation taken into account here.
Several publications recently have demonstrated a reduction in the percentage of intron-containing genes in higher vertebrate GPCRs. This is supported by the evidence presented here. In teleost fish about one half of all ora genes contain introns, whereas in Xenopus no introns are present (data not shown), and in mammalian V1Rs no incidence of introns has been reported. However, the explanations given for this reduction appear only partially applicable to the ora/V1R group of genes. A loss of introns has been suggested by Bryson-Richardson et al. (2004)
The other genomic feature novel for olfactory receptor genes is the occurrence of tightly linked symmetrical ora gene pairs, which are conserved throughout teleost evolution. The emergence of these gene pairs is not completely resolved, but the hypothesized whole genome duplications in the vertebrate lineage cannot be responsible, as the gene pairs are a local structure. In other cases of such gene pairs regulatory elements of one gene have been shown to lie in the other gene, enforcing linked evolution. Quite possibly some of these elements might even be shared among both genes of the pair (cf. Sumiyama et al. 2002 Taken together we have identified a novel family of six olfactory receptor genes in teleost fish. These genes are highly conserved between five evolutionarily distant fish species, in stark contrast to the frequent gene gains and gene losses seen in the related mammalian V1R family and other olfactory receptor families, both teleost and tetrapod.
Data mining All annotated V1R sequences were extracted either from the National Center for Biotechnology Information (NCBI) database resources or from the articles in which they were first published (for cow, dog, frog, fish, and opossum genes) and used as query sequences in subsequent analysis. Two combined different strategies were used to search the databases for new V1R-like candidate genes in five fish species and in frog. First, the algorithm TBLASTN was applied to compare amino acid query sequences to the DNA databases (http://www.ensembl.org/index.html) with a nonstringent expectation cutoff value of 10–10; second and last, the automatically ortholog predicted genes in the fish species were retrieved from each of the query sequences. To be considered as validated ora/V1R-like genes, a triage of the candidates was performed using different inclusion criteria. The confirmed ora/V1R-like genes were then included in subsequent analysis as new query sequences, until no new candidates were found. The inclusion criteria used were (1) position within the Ora/V1R-like clade in the phylogenetic analysis; (2) application of the BLASTP algorithm in the NCBI nonredundant database should result in annotated V1Rs or some other Ora/V1R-like candidates as first hits (expectation cutoff value of 10–10); (3) presence of typical V1R family motifs; (4) CDS length between 850 and 1250 amino acids; (5) presence of seven trans-membrane domains (based on the consensus of the prediction results obtained by using the TMHMM: http://www.cbs.dtu.dk/services/TMHMM/ and TMpred: http://www.ch.embnet.org/software/TMPRED_form.html servers). Duplicates genes were removed and the resulting genes were subjected to the analyses described below. The Xenopus tropicalis automatically annotated orthologs of the fish ora genes and mammalian V1Rs were also retrieved and included in the subsequent phylogenetic analysis. For GenBank accession numbers see Supplemental Table 1.
Phylogenetic analysis
Phylogenetic trees were constructed using the neighbor-joining method (Saitou and Nei 1987
Identity and Similarity matrix
Sequence logos
dN/dS analysis
To make inferences about selective pressure (positive and negative selection) on individual codons (sites) within the coding sequence of the 28 fish ora genes, the Single Likelihood Ancestor Counting (SLAC) package (http://www.datamonkey.org), which implements the Suzuki-Gojobori method (Suzuki and Gojobori 1999
The algorithm is briefly outlined. First, a best-fitting nucleotide substitution model was automatically selected by fitting several such substitution models to both the data and a neighbor-joining tree generated from the alignment described above. Taking the obtained substitution rates and branch lengths as constant, a codon model was employed to fit to the data and a global dN/dS ratio was calculated. Then a codon-by-codon reconstruction of the ancestral sequences was performed using maximum likelihood. Afterward, the expected normalized (ES) and observed numbers (EN) of synonymous (NS) and nonsynonymous (NN) substitutions were calculated for each nonconstant site. dN = NN/EN and dS = NS/ES were then computed, and if dN < dS (negative selection) or dN > dS (positive selection), a P-value derived from a two-tailed extended binomial distribution was used to assess significance. Tests on simulated data (S.L.K. Pond and S.D.W. Frost, methods available at http://www.datamonkey.org) show that P-values In the present study, two thresholds for significance (0.1 and 0.2) were taken into account in order to identify residues potentially involved in odorant-binding activities.
RT-PCR cDNA was generated by using standard protocols with an anchored oligo18(dT) reverse primer. PCR amplifications were performed by using the following primers: Dr_ actin (forward, CCCCATTGAGCACGGTATT; reverse, TCATGGAAGTCCACATG GCAGAAG), Dr ora1 (forward, ATGGACCTGTGTGTCACCAT CAAAGGCGT; reverse, TCATGGAAGTCCACATGGCAGAAG), Dr ora2 (forward, ATGATTGCGGAGGCTGTG; reverse, TCCACGTT GATGGCGTTC), Dr ora3 (forward, ATGGCGCCTCAAAAGA AACCC; reverse, AGATGAAGGCAGGGATGGAGT), Dr ora4 (forward, ATGTCTGAGGTCCTGACGGTG; reverse, GTGGTGCAGC TAATCACCATC), Dr ora5 (forward, ATGCAGCTCCAAGAC TGGGTT; reverse, GGAGTTGGGAATTTTTCCTCA), Dr ora6 (forward, ATGGTGATGGAGCAGATACAGGTGAATC; reverse, AG CACACTCGTCACCGTGA). Regions chosen for PCR primers did not exhibit any appreciable sequence identity to each other, thereby excluding cross-amplification. Whenever possible, intron-spanning primer pairs were chosen. The following conditions were used: 3 min at 96°C, followed by 35 cycles of 30 sec at 96°C, 30 sec at 60°C, and 60 sec at 72°C, and a final extension of 10 min at 72°C. All the ora PCR fragments were cloned into pDRIVE (Qiagen) and confirmed by sequencing (Supplemental Fig. 3).
In situ hybridizations
We thank Dr. Franco Weth for advice and help with the in situ hybridizations and Mehmet Saltürk for taking good care of the fish. L.R.S. is supported by the International Graduate School for Genetics and Functional Genomics (IGSGFG). Means for the project came from the University of Cologne, the IGSGFG, and the Deutsche Forschungsgemeinschaft (grant to S.I.K.).
1 Corresponding author.
E-mail Sigrun.Korsching@uni-koeln.de; fax 0049-221-470-5172. [Supplemental material is available online at www.genome.org.] Article published online before print. Article and publication date are at http://www.genome.org/cgi/doi/10.1101/gr.6553207
Alioto, T.S. and Ngai, J. 2006. The repertoire of olfactory C family G protein-coupled receptors in zebrafish: Candidate chemosensory receptors for amino acids. BMC Genomics 7: 309. doi: 10.1186/1471-2164-7-309.[CrossRef][Medline] Boschat, C., Pelofi, C., Randin, O., Roppolo, D., Luscher, C., Broillet, M.C., and Rodriguez, I. 2002. Pheromone detection mediated by a V1r vomeronasal receptor. Nat. Neurosci. 5: 1261–1262.[CrossRef][Medline] Bryson-Richardson, R.J., Logan, D.W., Currie, P.D., and Jackson, I.J. 2004. Large-scale analysis of gene structure in rhodopsin-like GPCRs: Evidence for widespread loss of an ancient intron. Gene 338: 15–23.[CrossRef][Medline] Buck, L. and Axel, R. 1991. A novel multigene family may encode odorant receptors: A molecular basis for odor recognition. Cell 65: 175–187.[CrossRef][Medline] Carmel, L., Rogozin, I.B., Wolf, Y.I., and Koonin, E.V. 2007. Evolutionarily conserved genes preferentially accumulate introns. Genome Res. 17: 1045–1050. Del Punta, K., Rothman, A., Rodriguez, I., and Mombaerts, P. 2000. Sequence diversity and genomic organization of vomeronasal receptor genes in the mouse. Genome Res. 10: 1958–1967. Dulac, C. and Axel, R. 1995. A novel family of genes encoding putative pheromone receptors in mammals. Cell 83: 195–206.[CrossRef][Medline] Fridmanis, D., Fredriksson, R., Kapa, I., Schioth, H.B., and Klovins, J. 2007. Formation of new genes explains lower intron density in Rhodopsin G protein-coupled receptors. Mol. Phylogenet. Evol. 43: 864–880.[CrossRef][Medline] Friedrich, R.W. and Korsching, S.I. 1998. Chemotopic, combinatorial, and noncombinatorial odorant representations in the olfactory bulb revealed using a voltage-sensitive axon tracer. J. Neurosci. 18: 9977–9988. Gojobori, T. 1983. Codon substitution in evolution and the "saturation" of synonymous changes. Genetics 105: 1011–1027. Grus, W.E., Shi, P., Zhang, Y.P., and Zhang, J. 2005. Dramatic variation of the vomeronasal pheromone receptor gene repertoire among five orders of placental and marsupial mammals. Proc. Natl. Acad. Sci. 102: 5767–5772. Hashiguchi, Y. and Nishida, M. 2005. Evolution of vomeronasal-type odorant receptor genes in the zebrafish genome. Gene 362: 19–28.[CrossRef][Medline] Herrada, G. and Dulac, C. 1997. A novel family of putative pheromone receptors in mammals with a topographically organized and sexually dimorphic distribution. Cell 90: 763–773.[CrossRef][Medline] Hoegg, S., Brinkmann, H., Taylor, J.S., and Meyer, A. 2004. Phylogenetic timing of the fish-specific genome duplication with the diversification of teleost fish. J. Mol. Evol. 59: 190–203.[CrossRef][Medline] Ishimaru, Y., Okada, S., Naito, H., Nagai, T., Yasuoka, A., Matsumoto, I., and Abe, K. 2005. Two families of candidate taste receptors in fishes. Mech. Dev. 122: 1310–1321.[CrossRef][Medline] Kumar, S., Tamura, K., and Nei, M. 2004. MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief. Bioinform. 5: 150–163. Lane, R.P., Young, J., Newman, T., and Trask, B.J. 2004. Species specificity in rodent pheromone receptor repertoires. Genome Res. 14: 603–608. Mank, J.E., Axelsson, E., and Ellegren, H. 2007. Fast-X on the Z: Rapid evolution of sex-linked genes in birds. Genome Res. 17: 618–624. Matsunami, H. and Buck, L.B. 1997. A multigene family encoding a diverse array of putative pheromone receptors in mammals. Cell 90: 775–784.[CrossRef][Medline] Meyer, A. and Schartl, M. 1999. Gene and genome duplications in vertebrates: The one-to-four (-to-eight in fish) rule and the evolution of novel gene functions. Curr. Opin. Cell Biol. 11: 699–704.[CrossRef][Medline] Mombaerts, P. 2004. Genes and ligands for odorant, vomeronasal and taste receptors. Nat. Rev. Neurosci. 5: 263–278.[CrossRef][Medline] Nei, M. and Gojobori, T. 1986. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 3: 418–426.[Abstract] Niimura, Y. and Nei, M. 2005. Evolutionary dynamics of olfactory receptor genes in fishes and tetrapods. Proc. Natl. Acad. Sci. 102: 6039–6044. Pfister, P. and Rodriguez, I. 2005. Olfactory expression of a single and highly variable V1r pheromone receptor-like gene in fish species. Proc. Natl. Acad. Sci. 102: 5489–5494. Rodriguez, I., Feinstein, P., and Mombaerts, P. 1999. Variable patterns of axonal projections of sensory neurons in the mouse vomeronasal system. Cell 97: 199–208.[CrossRef][Medline] Rodriguez, I., Del Punta, K., Rothman, A., Ishii, T., and Mombaerts, P. 2002. Multiple new and isolated families within the mouse superfamily of V1r vomeronasal receptors. Nat. Neurosci. 5: 134–140.[CrossRef][Medline] Rozas, J., Sanchez-DelBarrio, J.C., Messeguer, X., and Rozas, R. 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19: 2496–2497. Ryba, N.J. and Tirindelli, R. 1997. A new multigene family of putative pheromone receptors. Neuron 19: 371–379.[CrossRef][Medline] Saito, H., Mimmack, M.L., Keverne, E.B., Kishimoto, J., and Emson, P.C. 1998. Isolation of mouse vomeronasal receptor genes and their co-localization with specific G-protein messenger RNAs. Brain Res. Mol. Brain Res. 60: 215–227.[Medline] Saitou, N. and Nei, M. 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4: 406–425.[Abstract] Schiöth, H.B. and Fredriksson, R. 2005. The GRAFS classifcation system of G-protein coupled receptors in comparative perspective. Gen. Comp. Endocrinol. 142: 94–101.[CrossRef][Medline] Shi, P. and Zhang, J. 2007. Comparative genomic analysis identifies an evolutionary shift of vomeronasal receptor gene repertoires in the vertebrate transition from water to land. Genome Res. 17: 166–174. Stacey, N., Chojnacki, A., Narayanan, A., Cole, T., and Murphy, C. 2003. Hormonally derived sex pheromones in fish: Exogenous cues and signals from gonad to brain. Can. J. Physiol. Pharmacol. 81: 329–341.[CrossRef][Medline] Sumiyama, K., Irvine, S.Q., Stock, D.W., Weiss, K.M., Kawasaki, K., Shimizu, N., Shashikant, C.S., Miller, W., and Ruddle, F.H. 2002. Genomic structure and functional control of the Dlx3-7 bigene cluster. Proc. Natl. Acad. Sci. 99: 780–785. Suzuki, Y. and Gojobori, T. 1999. A method for detecting positive selection at single amino acid sites. Mol. Biol. Evol. 16: 1315–1328.[Abstract] Vanderhaeghen, P., Schurmans, S., Vassart, G., and Parmentier, M. 1993. Olfactory receptors are displayed on dog mature sperm cells. J. Cell Biol. 123: 1441–1452. Weth, F., Nadler, W., and Korsching, S. 1996. Nested expression domains for odorant receptors in zebrafish olfactory epithelium. Proc. Natl. Acad. Sci. 93: 13321–13326. Wolfe, K.H. and Sharp, P.M. 1993. Mammalian gene evolution: Nucleotide sequence divergence rat. J. Mol. Evol. 37: 441–456.[Medline] Zhang, X., Rodriguez, I., Mombaerts, P., and Firestein, S. 2004. Odorant and vomeronasal receptor genes in two mouse genome assemblies. Genomics 83: 802–811.[CrossRef][Medline]
Received March 28, 2007; accepted in revised format July 3, 2007.  CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Top
Abstract
Results
1000 genes in rodents (Buck and Axel 1991
) residues conserved in fish ora genes, but not in mammalian V1R genes.
0.1 identify nearly all true positives, with a false-positive rate generally below the nominal P-value; for actual data, the number of true positives at a given false-positive rate is lower. 
