Published online before print
August 12, 2003, 10.1101/gr.1356503
Genome Res. 13:2190-2194, 2003
©2003 by Cold Spring Harbor Laboratory Press; ISSN 1088-9051/03 $5.00
Methods
A New Method for Rapidly Generating Gene-Targeting Vectors by Engineering BACs Through Homologous Recombination in Bacteria
Vinícius Cotta-de-Almeida1,2,3,
Susan Schonhoff4,
Tomoyuki Shibata1,2,
Andrew Leiter4 and
Scott B. Snapper1,2,5
1 Gastrointestinal Unit and the Center for the Study of Inflammatory Bowel
Disease, Massachusetts General Hospital, Boston, Massachusetts 02114,
USA
2 Department of Medicine, Harvard Medical School, Boston, Massachusetts
02115, USA
3 Department of Ultrastructure and Cell Biology, Oswaldo Cruz Institute,
Oswaldo Cruz Foundation, Rio de Janeiro, 21045-900, Brazil
4 Division of Gastroenterology, GRASP Digestive Disease Center, New England
Medical Center/Tufts University School of Medicine, Boston, Massachusetts
02111, USA
 |
ABSTRACT
|
|---|
Generating knockout mice is still an expensive and highly time-consuming
process. Target construct generation, the first labor-intensive step in this
process, requires the manipulation of large fragments of DNA and numerous, and
often cumbersome, cloning steps. Here we show the development of a rapid
approach for generating targeting constructs that capitalizes on efficient
homologous recombination between linear DNA fragments and circular plasmids in
Escherichia coli ("recombineering"), the availability of
bacterial artificial chromosomes (BACs), and the accessibility of the sequence
of the mouse genome. Employing recombineering, we demonstrate with only
12 template plasmids, short homologies (4050bp) between donor
and target DNA, and one subcloning step that we can efficiently manipulate
BACs in situ to generate a complicated targeting vector. This procedure avoids
the need to construct or screen genomic libraries and permits the generation
of most standard, conditional, or knock-in targeting vectors, often within two
weeks.
The generation of knockout mice through gene targeting by homologous
recombination in embryonic stem (ES) cells is still an expensive and highly
time-consuming process. Knockout construct assembly is the first step in a
laborious process that can take up to a year even in the most technically
skilled laboratories. Typically, the process requires screening a genomic
library to obtain the gene of interest, followed by restriction mapping and
numerous cloning steps.
One strategy that can avoid time-consuming subcloning steps and may offer a
more efficient approach for generating targeting constructs is the use of
homologous recombination in Escherichia coli
(Eggleston and West 1996 ). The
basis of the technology is to utilize strains of E. coli that can
efficiently carry out homologous recombination between short terminal homology
regions on a linear PCR-derived DNA fragment and sequences on a recipient
plasmid. This strategy has been referred to as either recombineeringfor
recombinogenic engineering (Copeland et al.
2001 ; Court et al.
2002 )or recombination cloning
(Zhang et al. 2002 ). This
approach has been utilized to alter various DNA targets, including the E.
coli chromosome, high copy number plasmids, and bacterial artificial
chromosomes (BACs; Zhang et al.
1998 ,
2002 ;
Angrand et al. 1999 ;
Muyrers et al. 1999 ;
Datsenko and Wanner 2000 ;
Yu et al. 2000 ;
Copeland et al. 2001 ;
Lee et al. 2001 ;
Liu et al. 2003 ).
While two groups have employed this strategy for the construction of gene
targeting vectors, simplifying some of the time-consuming steps for targeting
vector construction, these approaches still required gene isolation or the
construction of genomic libraries and/or numerous complex gene manipulations
(Angrand et al. 1999 ;
Zhang et al. 2002 ). We desired
a construction strategy that would preclude the need to screen for and
subsequently map genomic sequences and, most importantly, would avoid all of
the cumbersome cloning steps. To simplify the process, we reasoned that one
could identify the genomic sequence of the gene of interest from publicly
available databases and then purchase an E. coli clone containing a
BAC encompassing these sequences rather than employing standard genomic
library screening. With the appropriately constructed template vectors
(described below) and the essential recombination machinery, we could then use
homologous recombination in E. coli to manipulate directly the gene
of interest in the BAC. Finally, in one step, we could remove the manipulated
sequence within the BAC by identifying flanking restriction sites from the
published sequence, and under appropriate antibiotic selection, generate a
targeting construct. Overall, this approach would obviate the need for the
numerous time-consuming cloning steps typically required for generating
complicated targeting constructs.
 |
RESULTS AND DISCUSSION
|
|---|
We sought to generate a variety of constructs for the conditional targeting
of the NOD2/CARD15 gene (the murine homolog of a novel Crohn's
disease gene; Hugot et al.
2001 ; Ogura et al.
2001 ). From available sequence databases, we identified the
NOD2 gene and purchased a BAC clone containing all 11 coding exons.
The overall strategy for generating a conditional targeting vector was to
employ two successive recombination steps to introduce a loxP site
5' to exon 3 and an aminoglycoside phosphotransferase (aph)
gene cassette (mediating kanamycin resistance or neomycin resistance when
expressed in prokaryotes or eukaryotes, respectively) flanked by loxP
sites ("floxed") 3' to exon 3 in the BAC clone
(Fig. 1). To mediate each
homologous recombination step, we introduced a plasmid containing the
arabinose-inducible Red recombination system from bacteriophage
(Murphy 1998 ;
Datsenko and Wanner 2000 ) into
the BAC containing strain.

View larger version (82K):
[in this window]
[in a new window]
|
Figure 1 Conditional knockout vector construction. (af)
Sequential steps leading to a NOD2 exon 3 recombinant BAC and
targeting vector (see text for details). (g) Gel electrophoresis
depicting PCR products confirming the recombinants schematized in diagrams:
(a) lane 1 (WT-BAC), (b) lane 2
(BACloxP/frt/aph/frt), and
(c) lane 3 (BACloxP),
generated with primers 1 (P1) and 2 (P2); (d) lane 4
(BACloxP) and (e) lane 5
(BACloxP-loxP/aph/loxP),
generated with P3 and P4; and (f) lanes 6,7 (targeting
construct) using respectively P3 and P4, and P1 and P4. Circled
"F", frt site; large arrowhead, loxP site.
|
|
In the first recombination step, intronic BAC sequences 5' to exon 3
were targeted with PCR products containing a loxP site and an
frt-flanked aph gene
(Fig. 1a). These PCR products
were amplified with 60-bp primer pairs consisting of 40 bp of sequence
homologous to the intronic region flanking the targeted exon, and 20 bp
complementary to the template plasmid containing the DNA to be inserted
(Fig. 1a). The template
plasmid, pKD4Lox, was derived from pKD4
(Datsenko and Wanner 2000 ), a
conditional replicon (oriR ) that requires the pir gene product
(absent in most E. coli strains that carry BACs) for replication.
Transformation with the loxP/aph-containing PCR fragment
resulted in several kanamycin-resistant (KnR) recombinants
(Fig. 1b). Following
transformation with a temperature-sensitive replicon that expresses the flp
recombinase (Cherepanov and Wackernagel
1995 ), which recognizes frt sites, the aph gene
was excised by site specific recombination
(Fig. 1c).
The second step was to manipulate BAC intronic sequence 3' to exon 3.
Kanamycin-sensitive strains isolated above
(Fig. 1c) were targeted with a
PCR product containing a floxed aph cassette generated from pSBS150.
This pKD4-based template contains the aph gene under the control of
both prokaryotic and eukaryotic promoters to allow selection in bacterial and
ES cells (Fig. 1d). From the
genomic sequence, we identified a restriction enzyme site (KpnI)
flanking the manipulated exon that would yield a fragment of sufficient length
for homologous recombination in ES cells
(Fig. 1e). To isolate the
construct, the recombinant BAC was digested with KpnI, and the
fragments were subcloned into a multicopy cloning vector (e.g., pBluescript or
a thymidine kinase [TK]-containing plasmid;
Fig. 1f), and selected for
ampicillin resistant (ApR) and KnR colonies. The
presence of the aph gene within the region of the BAC of interest
allowed, upon kanamycin selection, enrichment of clones containing only the
desired DNA fragments. PCR (Fig.
1g), restriction enzyme, and sequencing analyses confirmed the
desired products in all steps.
We also developed a similar method for a "one-step" targeting
strategy that would be applicable for either conditional knockout targeting
construct generation or for the "knock-in" of a mutated exon. We
first generated pSBS156, another conditional replicon. This plasmid contained
a unique EcoRI site to allow the cloning of a wild-type or
"mutated" exon of interest flanked by a loxP sequence and
a floxed aph gene cassette (Fig.
2a). Subsequently, we developed a NOD2
"knock-in" template by introducing into pSBS156 a mutated exon 10
that corresponded to the mutant genotype in CD
(Fig. 2b, pSBS158;
Hugot et al. 2001 ;
Ogura et al. 2001 ). Homologous
recombination between linear PCR fragments and the BAC generated
KnR recombinants containing the mutated exon and a 3' floxed
aph gene, but not the 5' loxP. To
circumvent this recombination that occurred within the exon (which would be
incompatible with a conditional targeting construct), we increased the
homology arm in the sense primer to 50 bp, and selected a target sequence
located 100 bp upstream of the mutated exon as the 5' region for
homologous recombination. Appropriate recombinants were identified and
confirmed (Fig. 2c,e).
Restriction analyses of the recombinant BACs revealed the absence of unwanted
internal rearrangements (data not shown). A targeting construct was generated
by digesting the recombinant BAC with NheI, followed by subcloning
into a TK-containing vector and selection on ampicillin/kanamycin
plates (Fig. 2d).

View larger version (122K):
[in this window]
[in a new window]
|
Figure 2 "Knock-in" vector construction. (ad)
Sequential steps leading to a mutated NOD2 exon 10
"knock-in" BAC and targeting construct (see text for details);
(e) Gel electrophoresis depicting PCR products confirming the
recombinants schematized in diagrams: (c) lane 1 (WT-BAC),
(d) lane 2 (BACloxP/exon 10m/loxP/aph/loxP), and
(e) lane 3 (the targeting vector), generated with P5 and
P6.
|
|
Although not described here, construction of simple targeting vectors that
aim to replace a portion of a gene with an aph gene cassette can be
generated using pSBS150 as template. PCR primers homologous to the sequence
flanking the deleted regions can be used to generate a linear fragment for
homologous recombination with the BAC. It was previously shown that primers
designed in this way efficiently loop out intervening sequence with
replacement by the selectable marker
(Zhang et al. 1998 ;
Angrand et al. 1999 ;
Datsenko and Wanner 2000 ;
Yu et al. 2000 ).
Two groups previously described methods for the construction of targeting
vectors utilizing recombineering (Angrand
et al. 1999 ; Zhang et al.
2002 ). Both of these approaches required screening genomic
libraries and did not utilize the availability of BACs. Here we describe a
simple and rapid method of generating complex gene knockout targeting
constructs using recombination engineering requiring only one or two plasmid
templates (Figs. 1,
2). This approach exploits the
commercial availability of mouse genomic BAC clones spanning known sequences
in the mouse genome. Since they can accommodate 510-fold larger inserts
than bacteriophage, the use of BACs ensures that sufficient sequence is
available to generate large regions of homology required for efficient
homologous recombination in ES cells. Furthermore, this strategy avoids
library construction and most subcloning steps that are characteristic of
conditional targeting construct generation, and can be applied to the rapid
generation of most standard, conditional, or knock-in targeting vectors.
While our work was being finalized for publication, another
recombineering-based approach that manipulated BACs for the generation of
targeting vectors was reported (Liu et al.
2003 ). Those authors employ gap-repair for the sub-cloning of a
BAC fragment into a recipient plasmid, followed by further targeting of this
plasmid to construct a conditional targeting vector. Although both approaches
utilize recombineering and BAC DNA sequences for vector construction, there
are unique and notable distinctions. Because we did not use Cre recombinase in
the BAC targeting process, the presence of loxP sites in the BAC
vectors has not posed any constraints to the insertion of further
loxP sites for conditional targeting vector construction. On the
other hand, the presence of three loxP sites leads to three
possibilities of recombinants when the Cre recombinase is expressed in ES
cells; the utilization of additional sequences (e.g., frt sites) which orient
site-specific deletion can further simplify this process
(Liu et al. 2003 ). In addition,
in our approach, the requirement for unique restriction sites in the BAC that
are located outside the regions of homology is one potential obstacle.
Although we have been able to generate three different targeting constructs
using this approach without difficulty, one can circumvent this obstacle by
subcloning via gap repair (Liu et al.
2003 ).
Most importantly, in our studies, we manipulated BACs in situ in the
original host, which avoids numerous subcloning steps and permits additional
uses of this technology. Furthermore, we utilized a plasmid, rather a
prophage, to encode the lambda Red recombination system and achieved efficient
recombination utilizing only two templates for all targetings and very short
terminal homologies (4050 bp). Short homologies did not pose any
constraint to our targetings. We achieved a specific targeting efficiency of
65%±30% for eight unique targetings within four different genes
(average total number of colonies tested per targeting: 13±9; average
number of correct colonies identified per targeting: 7±3). Aberrant
recombination in the alternative approach employing gap repair may have
resulted from short homologies between the donor sequences and repetitive
sequences in the target DNA (Liu et al.
2003 ). It is likely that this potential problem can be avoided by
surveying the BAC sequence prior to designing primers, to avoid using
repetitive sequences for the site of recombination. Finally, manipulating BACs
directly can permit the use of the entire BAC as a targeting construct in ES
cellsavoiding constraints on the size of the homology arms.
 |
METHODS
|
|---|
Construction of Template Plasmids
The template plasmids pKD4Lox, pSBS150, and pSBS158 were derived from pKD4,
and each maintained in pir+ bacteria
(Datsenko and Wanner 2000 ). The
use of pKD4 as the backbone was essential to prevent replication of the
template plasmid in transformed strains.
pKD4Lox was constructed by cloning a single loxP site upstream of
the frt-flanked TN5-aph segment in pKD4. pSBS150 was
constructed by cloning a floxed aph gene (driven by both TN5 and PGK
promoters) in the pKD4 vector double-digested with
BamHI/NcoI. To allow single targeting of BACs (see below),
pSBS156 was generated from pSBS150 by cloning a loxP site upstream of
the floxed aph gene. pSBS158 was constructed by cloning the mutated
CARD15 exon (see text) into a unique EcoRI site located between the
loxP sequence and the floxed aph gene cassette in pSBS156
(see Fig. 2b).
Generation of BAC Targeting Constructs
PCR products for BAC targeting were generated with 6074-bp primer
pairs using Advantage 2 polymerase (Clontech). Within each primer, the first
4054 bp (homology arm) was homologous to the BAC sequence, and the next
20 bp was complementary to the template plasmid of interest. The 60-bp
sequences to prime pKD4Lox, pSBS150, and pSBS158 (and further BAC targeting)
were, respectively: CCTTGTTTAACCATATCAAAGTTCCCG GCTGTAT
TCCTGCTCTTGAGCGATTGTGTAGGC (forward) and GGACCCAGGGGCTTCC TAAACCTGGTTCTTCCCCTG
CAA ACATATGAATATCCTCCTTAG (reverse), ATT CCACCTCTGC
CACCCTTCATACAACACCAGCCAGACCCCGATCATA TTCAATA ACCC (forward) and
GCTATAGTTATTTGTTCT GAAACTAAGGCCCAGAAGAGGG CTATGCTACTCCGT CAATAA (reverse),
AGCCTGGCAATGAGCTGTGGCTCCT CAGCCCTTCCTCCCTTCCCAGTGTGGGTACCGGGGG ATCCGGAACCCTT
(forward) and ATACCAAATGTTG GTCA AAACTGATCTTCAGAATTCCACCCTATG CTACTCCGTCAATAA
(reverse). Each PCR product (1.6-, 2.2-, and 2.5-Kb in length for pKD4Lox,
pSBS150, and pSBS158, respectively) was purified (QIAquick PCR purification
kit, QIAGEN), digested with DpnI (New England Biolabs),
ethanol-precipitated, and resuspended in Tris-Cl buffer pH 8.5.
Two-Step BAC Gene Targeting
Bacteria carrying the target BAC and pKD46 ( Red recombination
system) were grown in 100-mL LB cultures with chloramphenicol (12.5 µg/mL),
ampicillin (100 µg/mL), and L-arabinose (150 µg/mL, Sigma) at 30°C
to an OD600 of 0.6. Electrocompetent bacteria were transformed
with 100 ng of the pKD4Lox-amplified and aph gene-containing PCR
construct. Chloramphenicol-resistant (CmR)/KnR
transformants were first replated to confirm adequate resistance, and then
screened by PCR (using P1 and P2 primers, AGCCCTGCCCCCTT CTATTT and
TCACAGCGGGACCTACACAG, respectively; see
Fig. 1), and the PCR products
were sequenced to confirm the desired targeting. Positive colonies were grown
overnight at 42°C to cure pKD46 (confirmation was performed by testing
ampicillin sensitivity). In order to remove the aph gene, a single
CmR/KnR and ampicillin-sensitive colony was transformed
with pCP20 (an ApR and temperature-sensitive replicon containing
the thermally-induced flp recombinase gene;
Cherepanov and Wackernagel
1995 ) and grown overnight at 30°C on
chloramphenicol/ampicillin plates. Some colonies were selected again in
chloramphenicol plates at 43°C, and then tested for kanamycin sensitivity
(i.e., loss of the aph gene) and loss of ampicillin resistance (i.e.,
the curing of pCP20).
A single CmR and kanamycin-sensitive colony was transformed with
pKD46. Chloramphenicol/ampicillin selected transformants were then transformed
with 100 ng of the pSBS150-amplified (containing the floxed aph gene)
PCR product. As detailed above, to confirm the desired targeting,
CmR/KnR transformants were first screened by PCR and
sequencing (using P3 and P4 primers, TGGGCCTGTGACAAATGCTACTG and
GTTGTGGGGATGGAT GGGGTTATT, respectively; see
Fig. 1), and then cured of
pKD46.
Mutation of the Target Exon
PCR amplification of mNOD2/CARD15 exon 10 was performed in the BAC
clone RP23447G4, and the product was subcloned in PCR4-TOPO (TOPO TA
cloning kit, Invitrogen). A mutation analogous to the 3020incC frameshifit
mutation in NOD2/CARD15 found in Crohn's disease patients
(Hugot et al. 2001 ;
Ogura et al. 2001 ) was
introduced into this subclone, using site-directed mutagenesis (QuickChange
site-directed mutagenesis kit, Stratagene).
One-Step BAC Gene Targeting
pSBS158 was used as the template for the one-step BAC targeting in E.
coli. This targeting used the same BAC clone and was performed as
described above for the two-step targeting protocol. Confirmation of the
desired recombinant BAC was performed by PCR screening and sequencing (using
primers P5 and P6, TGGGCCTGTGACAAATGCTACTG and GTTGTGGGGATGGATGGGGTTATT,
respectively; see Fig. 2).
Generation of the Targeting Vector
In both targeting strategies, the desired recombinant BAC DNA ( 50
µg) was digested with a suitable restriction enzyme in order to achieve
homology arms with appropriate size for further homologous recombination in ES
cells. Following digestion, BAC DNA was shotgun-cloned into a linearized
pBluescript-derived TK-containing vector, and the desired
transformants were selected by growth on ampicillin/kanamycin plates.
 |
Acknowledgements
|
|---|
We gratefully acknowledge members of the Snapper laboratory for their
support and the critical reading of the manuscript by Drs. Daniel Podolsky,
Vijay Yajnik, Antonio Oliveira-dos-Santos, Sheila Thomas and Anna Lyubimova.
These studies were supported by the National Institutes of Health (AI50950 and
HL59561S.B.S.) and by CAPES (Fundação
Coordenação de Aperfeiçoamento de Pessoal de Nível
Superior/BrazilV.C.-A.).
The publication costs of this article were defrayed in part by payment of
page charges. This article must therefore be hereby marked
"advertisement" in accordance with 18 USC section 1734 solely to
indicate this fact.
 |
Footnotes
|
|---|
Article and publication are at
http://www.genome.org/cgi/doi/10.1101/gr.1356503. Article published online
before print in August 2003.
5 Corresponding author. E-MAIL
ssnapper{at}hms.harvard.edu;
FAX (617) 726-2373. 
 |
REFERENCES
|
|---|
Angrand, P.O., Daigle, N., van der Hoeven, F., Scholer, H.R., and
Stewart, A.F. 1999. Simplified generation of targeting constructs
using ET recombination. Nucleic Acids Res.
27: 16.
Cherepanov, P.P. and Wackernagel, W. 1995. Gene
disruption in Escherichia coli: TcR and KmR cassettes with the option
of Flp-catalyzed excision of the antibiotic-resistance determinant.
Gene 158:
914.[CrossRef][Medline]
Copeland, N.G., Jenkins, N.A., and Court, D.L. 2001.
Recombineering: A powerful new tool for mouse functional genomics.
Nat. Rev. Genet. 2:
769779.[Medline]
Court, D.L., Sawitzke, J.A., and Thomason, L.C. 2002.
Genetic engineering using homologous recombination. Annu. Rev.
Genet. 36:
361388.[CrossRef][Medline]
Datsenko, K.A. and Wanner, B.L. 2000. One-step
inactivation of chromosomal genes in Escherichia coli K-12 using PCR
products. Proc. Natl. Acad. Sci.
97:
66406645.[Abstract/Free Full Text]
Eggleston, A.K. and West, S.C. 1996. Exchanging
partners: Recombination in E. coli. Trends Genet.
12:
2026.[CrossRef][Medline]
Hugot, J.P., Chamaillard, M., Zouali, H., Lesage, S., Cezard, J.P.,
Belaiche, J., Almer, S., Tysk, C., O'Morain, C.A., Gassull, M., et al.
2001. Association of NOD2 leucine-rich repeat variants with
susceptibility to Crohn's disease. Nature
411:
599603.[CrossRef][Medline]
Lee, E.C., Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing,
D.A., Court, D.L., Jenkins, N.A., and Copeland, N.G. 2001. A
highly efficient Escherichia coli-based chromosome engineering system
adapted for recombinogenic targeting and subcloning of BAC DNA.
Genomics 73:
5665.[CrossRef][Medline]
Liu, P., Jenkins, N.A., and Copeland, N.G. 2003. A
highly efficient recombineering-based method for generating conditional
knockout mutations. Genome Res.
13:
476484.[Abstract/Free Full Text]
Murphy, K.C. 1998. Use of bacteriophage
recombination functions to promote gene replacement in Escherichia coli.
J. Bacteriol. 180:
20632071.[Abstract/Free Full Text]
Muyrers, J.P., Zhang, Y., Testa, G., and Stewart, A.F.
1999. Rapid modification of bacterial artificial chromosomes by
ET-recombination. Nucleic Acids Res.
27:
15551557.[Abstract/Free Full Text]
Ogura, Y., Bonen, D.K., Inohara, N., Nicolae, D.L., Chen, F.F.,
Ramos, R., Britton, H., Moran, T., Karaliuskas, R., Duerr, R.H., et al.
2001. A frameshift mutation in NOD2 associated with
susceptibility to Crohn's disease. Nature
411:
603606.[CrossRef][Medline]
Yu, D., Ellis, H.M., Lee, E.C., Jenkins, N.A., Copeland, N.G., and
Court, D.L. 2000. An efficient recombination system for
chromosome engineering in Escherichia coli. Proc. Natl. Acad.
Sci. 97:
59785983.[Abstract/Free Full Text]
Zhang, P., Li, M.Z., and Elledge, S.J. 2002. Towards
genetic genome projects: Genomic library screening and gene-targeting vector
construction in a single step. Nat. Genet.
30:
3139.[CrossRef][Medline]
Zhang, Y., Buchholz, F., Muyrers, J.P., and Stewart, A.F.
1998. A new logic for DNA engineering using recombination in
Escherichia coli. Nat. Genet.
20:
123128.[CrossRef][Medline]
Received March 20, 2003;
accepted in revised format June 10, 2003.

CiteULike Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. Feng, X. Xie, Q. Ding, X. Luo, J. He, F. Fan, W. Liu, Z. Wang, and Y. Chen
Spatial regulation of Raf kinase signaling by RKTG
PNAS,
September 4, 2007;
104(36):
14348 - 14353.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Chan, N. Costantino, R. Li, S. C. Lee, Q. Su, D. Melvin, D. L. Court, and P. Liu
A recombineering based approach for high-throughput conditional knockout targeting vector construction
Nucleic Acids Res.,
April 10, 2007;
(2007)
gkm163v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Flaherty, B. Herron, and D. Symula
Genomics of the future: Identification of quantitative trait loci in the mouse
Genome Res.,
December 1, 2005;
15(12):
1741 - 1745.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Schonhoff, L. Baggio, C. Ratineau, S. K. Ray, J. Lindner, M. A. Magnuson, D. J. Drucker, and A. B. Leiter
Energy Homeostasis and Gastrointestinal Endocrine Differentiation Do Not Require the Anorectic Hormone Peptide YY
Mol. Cell. Biol.,
May 15, 2005;
25(10):
4189 - 4199.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Aoyama, K. Agari, G.-H. Sun-Wada, M. Futai, and Y. Wada
Simple and straightforward construction of a mouse gene targeting vector using in vitro transposition reactions
Nucleic Acids Res.,
March 22, 2005;
33(5):
e52 - e52.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Warming, N. Costantino, D. L. Court, N. A. Jenkins, and N. G. Copeland
Simple and highly efficient BAC recombineering using galK selection
Nucleic Acids Res.,
February 24, 2005;
33(4):
e36 - e36.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Zhou, J.-X. Ren, T. M. Ryan, N. P. Higgins, and T. M. Townes
Rapid tagging of endogenous mouse genes by recombineering and ES cell complementation of tetraploid blastocysts
Nucleic Acids Res.,
September 8, 2004;
32(16):
e128 - e128.
[Abstract]
[Full Text]
[PDF]
|
 |
|
|
|