Published online before print
June 12, 2003, 10.1101/gr.709603
Genome Res. 13:1728-1736, 2003
©2003 by Cold Spring Harbor Laboratory Press; ISSN 1088-9051/03 $5.00
Methods
Analysis of mRNA With Microsomal Fractionation Using a SAGE-Based DNA Microarray System Facilitates Identification of the Genes Encoding Secretory Proteins
Nobuaki Toyoda 1,2,
Shigenori Nagai1,
Yuya Terashima1,
Kazushi Motomura1,
Makoto Haino1,
Shin-ichi Hashimoto1,
Hajime Takizawa2 and
Kouji Matsushima1,3
1 Department of Molecular Preventive Medicine & SORST, School of
Medicine, The University of Tokyo, Bunkyo-ku, Tokyo 113-0033, Japan
2 Department of Respiratory Medicine, School of Medicine, The University of
Tokyo, Bunkyo-ku, Tokyo 113-8655, Japan
 |
ABSTRACT
|
|---|
In the regulation of host defense responses such as inflammation and
immunity, the secretory proteins, including membrane proteins, play central
roles. Although many secretory proteins have been identified by using methods
such as differential display, random screening, or the signal sequence trap
method, each method suffers from poor reproducibility, low sensitivity, or
time-consuming or laborious work. Therefore, the strategy for facilitating the
selection of the genes encoding the secretory proteins is desired. In this
paper, we describe a system for isolating the genes encoding secretory
proteins by analyzing mRNAs with microsomal fractionation on serial analysis
of gene expression (SAGE)–based DNA microarray system. This system
succeeded in discriminating the genes encoding secretory proteins from ones
encoding nonsecretory proteins with 80% accuracy. We applied this system to
human T lymphocytes. As a result, we were able to identify the genes that are
not only encoding secretory proteins but also expressing selectively in a
specific subset of T lymphocytes. The SAGE-based DNA microarray system is a
promising system to identify the genes encoding specific secretory
proteins.
Most of the secretory proteins—such as receptors, transporters,
adhesion molecules, hormones, cytokines, and chemokines—play central
roles in homeostatic and host defensive responses; therefore, identification
of novel secretory proteins may lead to further clarification of molecular
mechanisms of life phenomena and establishment of new therapies for human
diseases. Many secretory proteins have been identified by using differential
display (Liang and Pardee
1992 ), random screening, and the signal sequence trap method
(Tashiro et al. 1993).
However, those methods appeared unlikely to be suitable for the comprehensive
identification of the genes encoding secretory proteins for which expression
is dynamically regulated in response to particular external stimuli. This is
because differential display suffers from poor reproducibility, random
screening suffers from time-consuming and laborious work, and the signal
sequence trap method suffers from low sensitivity.
The comprehensive search for expressed genes by serial analysis of gene
expression (SAGE) reveals not only known but also novel transcripts present
within RNA population studied (Velculescu
et al. 1995). However, it is generally difficult to predict
whether the gene encodes secretory or nonsecretory protein from the SAGE tag.
We solved this obstacle by analyzing mRNA with subcellular fractionation by
using DNA microarray (Diehn et al.
2000). Consequently, we were able to develop a SAGE-based DNA
microarray system that is efficient in identifying the genes encoding novel
secretory proteins (Fig 1).
View larger version (18K):
[in this window]
[in a new window]
|
Figure 1 The strategy for identifying the genes encoding secretory proteins for
which expression is dependent on the cell types or the cell states. In the
present study, our strategy was applied to human T lymphocytes. First, SAGE
was performed to reveal genes selectively expressed under specific T
lymphocyte conditions such as activated Th1, activated Th2, or activated T
lymphocytes. Second, the specific genes were collected by using 3' RACE.
Finally, by using a DNA microarray system, the genes encoding secretory
proteins were identified by analyzing RNAs from the free ribosomal and the
microsomal fraction after equilibrium density–gradient
centrifugation.
|
|
In our previous paper, we constructed the expression profile of human
activated Th1 lymphocytes and that of human activated Th2 lymphocytes by using
SAGE technology (Nagai et al.
2000). In addition, we performed SAGE on human resting
CD4+ T lymphocytes. We show here that the genes encoding secretory
proteins in a specific subset of human T lymphocytes are identified
efficiently by using the SAGE-based DNA microarray system.
|
RESULTS
|
|---|
Screening of the Genes Expressed Selectively in Specific Subsets of T
Lymphocytes
In activated Th1-, activated Th2-, and resting CD4+ T lymphocyte
SAGE libraries, a total of 32,219, 32,291, and 62,459 tags, respectively, were
sequenced. To identify individual genes, the expressed genes were analyzed
with the National Center for Biotechnology Information (NCBI) SAGE database
(http://www.ncbi.nlm.nlh.gov/SAGE/).
Those SAGE results permitted selecting the genes satisfying the following
criteria: (1) the genes encode hypothetical proteins or ESTs on 2002.1; (2)
the genes encode proteins expressed selectively in either activated Th1 or Th2
lymphocytes, or selectively induced by activated T lymphocytes; and (3) the
genes correspond with the products amplified by 3' RACE. The genes
satisfying these criteria are listed in
Table 1. Ten genes were
selected from activated Th1 lymphocytes, one gene from activated Th2
lymphocytes, and 20 genes from activated T lymphocytes.
Isolation of Membrane-Bound Polysomes From Activated T
Lymphocytes
We performed equilibrium density–gradient centrifugation to separate
microsomes and free ribosomes from the peripheral blood mononuclear cells
(PBMCs) stimulated with phorbol myristate acetate (PMA) and ionomycin
(Mechler and Rabbitts 1981;
Mueckler and Pitot 1981;
Mechler 1987). The separation
into the free and membrane-bound polysomes from the PBMCs was confirmed by
reverse transciption–polymerase chain reaction (RT-PCR;
Fig. 2A). We arbitrarily
selected GATA3 and G3PDH for cytoplasmic proteins; CD48, CXCR4, and CCR7 for
cell surface molecules; and IFN and MIP1 for secreted proteins.
Figure 2A shows that
cytoplasmic genes such as GATA3 and G3PDH are rich in the free ribosome
fraction, and secreted and membrane-associated genes such as IFN,
MIP1, CD48, CXCR4, and CCR7 are rich in the microsome fraction.
Identification of the Genes Encoding Secretory Proteins
Fluorescently labeled cDNA was synthesized from each fraction (Cy5-labeled
cDNA for membrane-associated mRNA, and Cy3-labeled cDNA for cytosolic mRNA).
The Cy3- and Cy5-labeled cDNAs were simultaneously hybridized to the genes on
the microarray glass slide. Figure
2B shows the distribution of Cy5/Cy3 fluorescent intensity ratio
of 379 genes for which subcellular localization has been established. The
ratio of the fluorescent intensity of the genes encoding proteins of known
subcellular localization is used as internal control. Eighty percent of genes
encoding cytoplasmic proteins are <1.35 in Cy5/Cy3 ratio; on the other
hand, 80% of genes encoding secretory proteins >1.37 in Cy5/Cy3 ratio.
Selection of the Novel Genes Encoding Secreted and
Membrane-Associated Molecules
Among the genes in Table 1,
nine genes had a Cy5/Cy3 ratio >1.35, suggesting that these genes encode
secretory proteins (six cDNAs encoding hypothetical proteins and 3'
ESTs). Two genes are expressed selectively on activated Th1 lymphocytes, one
gene on activated Th2 lymphocytes, and six genes on activated T lymphocytes.
By using the algorithms such as SOSUI
(http://sosui.proteome.bio.tuat.ac.jp)
and PSORTII
(http://psort.nibb.ac.jp/form2.html),
their subcellular localization was predicted
(Fig. 3). The hypothetical
protein encoded by Hs.286131 gene, of which expression is selective
in activated Th1 lymphocytes, has four transmembrane domains. Although the
product of Hs.7718 gene selectively expressed in activated Th2 lymphocytes has
no transmembrane domain in accordance with the algorithms, the ratio of its
fluorescent intensity (Cy5/Cy3 = 1.73) was sufficiently high to be a secretory
protein. This discrepancy was due to the incomplete information of the
sequence of Hs.7718 cDNA in the public database. Although it is
reported in the public database that the product of Hs.7718 gene comprised of
522 amino acids, the full-length cDNA of this gene turned out to encode a
protein comprising 775 amino acids with a signal sequence at the N-terminal
portion (Nielsen et al. 1997).
Hs.349306 gene product has 13 predicted transmembrane domains, which suggests
that this product is a seven-transmembrane receptor selectively induced in
activated T lymphocytes. Hs.99486 gene product has a signal sequence and a
transmembrane domain.
View larger version (27K):
[in this window]
[in a new window]
|
Figure 3 Predicted structures of six hypothetical proteins and RT-PCR analysis of
their expression level. By using an algorithm such as SOSUI and PSORTII,
transmembrane domains of the six hypothetical proteins were predicted on the
basis of the presumed human ortholog. Sequences were obtained from the public
database. In the column predicted structure, the black oval represents
putative signal sequence; the black boxes, putative transmembrane
domains. RT-PCR was performed on total RNA isolated to confirm SAGE results.
Th1, Th2, act T, and res T indicate activated Th1 lymphocytes, activated Th2
lymphocytes, activated T lymphocytes, and resting T lymphocytes, respectively.
The Cy5/Cy3 fluorescent ratio is a value that is given to each gene by the
microarray analysis; candidates of secretory proteins have Cy5/Cy3 fluorescent
ratios >1.35.
|
|
Full-Length cDNA Cloning of Hs.182285
To examine whether secretory proteins can be identified from the limited
information of the EST of 3'-site, the full-length cDNA cloning of
Hs.182285 gene was conducted. The result indicated that
Hs.182285 cDNA encodes a novel protein comprising 167 amino acids,
which has four predicted transmembrane domains, as shown in
Figure 4.
View larger version (14K):
[in this window]
[in a new window]
|
Figure 4 Amino acid sequence of Hs.182285 gene product. 5' RACE analysis
reveals the predicted structure of Hs.182285 gene product. Hs.182285 gene
product comprises 167 amino acids. The four predicted transmembrane domains
are shown by the underlines.
|
|
Analysis of In Vitro Translated Hs.7718 Gene Product
To assess the topology of Hs.7718 gene product relative to the microsomal
vesicle membranes, proteinase K susceptibility studies was performed
(Fig. 5A). The in vitro
translated Hs.7718 gene product resolved at  106 kD on SDS-PAGE, which is
20 kD larger than the size calculated from amino acid sequence
(Fig. 5A, the first lane).
Hs.7718 gene product translated in the presence of microsome showed higher
molecular weight even after treatment with proteinase K
(Fig. 5A, the second lane),
which is possibly due to N-glycosylation at amino acids 138–141 and
amino acids 361–364. Upon disruption of the microsomal membrane, Hs.7718
gene product was completely degraded (the third lane). Together, these results
indicate that Hs.7718 gene product is a secretory protein.
View larger version (51K):
[in this window]
[in a new window]
|
Figure 5 (A) Autoradiogram demonstrating the susceptibility of Hs.7718 gene
product to proteinase K when translated in vitro in the presence of microsomal
vesicles (microsomes). Equal aliquots of each translation reaction were
exposed to proteinase K in the absence (-) or presence (+) of Triton X-100.
(B) HEK293 cells overexpressing green fluorescent protein
(GFP)–fused Hs.182285 gene product. HEK293 cells expressing GFP-fused
Hs.182285 gene product (left) were fixed, and the membrane is labeled
with DilC12 (center). Images were merged (right). When
GFP-fused Hs.182285 gene product distribution is compared with the membrane
labeling in red performed with DilC12, the GFP fluorescent signal was
identical to the plasma membrane.
|
|
Hs.182285 Gene Product–Green Fluorescent Protein Distributed
Through the Plasma Membrane
To directly visualize the intracellular distribution of Hs.182285 gene
product, we expressed chimera consisting of Hs.182285 gene product fused to
green fluorescent protein (GFP) in cultured HEK293 cells and examined the GFP
fluorescence by laser-scanning confocal microscopy. The Hs.182285-GFP fused at
the C terminus was dispersed throughout the plasma membrane
(Fig. 5B). There is no
difference in distribution between Hs.182285 gene product with GFP at the N
terminus and at the C terminus. In addition, Hs.182285-GFP fusion protein
mostly merged with membrane marker DilC12
(Fig. 5B). These results
indicate that Hs.182285 gene product is indeed located at the plasma
membrane.
|
DISCUSSION
|
|---|
Intercellular communication between secreted proteins and membrane
receptors plays a central role in most fundamental biological processes. In
addition, secretory proteins are the most probable therapeutic agents, or
targets, for antagonistic or agonistic therapy. Therefore, the development of
efficient systems for identifying the genes encoding secretory proteins has
been desired.
So far, several strategies for identifying secretory proteins have been
developed. One is the signal sequence trap method that takes advantage of a
characteristic N-terminal signal peptide sequence. However, this strategy has
difficulty in identifying novel specific secretory protein genes, because
unequal representation of different messages makes the identification of
weakly expressed genes difficult and because comparisons among the expression
profiles of multiple samples cannot be performed. Another is a genome-wide
screening method using DNA microarray
(Diehn et al. 2000); DNA
microarray analysis of mRNAs with subcellular fractionation reveals candidate
genes encoding secretory proteins. This strategy cannot be applied to identify
the genes encoding secretory proteins that are expressed in response to
particular external stimuli because of the following reasons. One is that DNA
microarray analysis is limited by the ability to analyze only previously
isolated genes. Furthermore, it is usually difficult for laboratories to
collect, verify, and manage thousands of genes for DNA microarray analysis,
and many genes represented on the microarrays cannot be assessed because they
are not expressed at a sufficient level. Another reason is that it is
difficult to prepare sufficient materials in specific conditions such as
Th1-polarized lymphocytes or Th2-polarized lymphocytes for the purpose of
discriminating secretory proteins from nonsecretory proteins by equilibrium
sediment–density centrifugation. Our strategy could be applied to
identify the genes expressed in a limited amount of samples.
The striking feature of our system is the ability to isolate not only the
genes that are encoding secretory proteins but also dynamically regulated
proteins in response to particular external stimuli. In addition, our system
can identify novel genes without interference of highly expressed genes. This
is the fundamental limitation in identifying novel specific secretory protein
genes. We have overcome this problem by analysis of mRNA with subcellular
fractionation by using the SAGE-based DNA microarray system. In this study, we
found that the SAGE-based DNA microarray system is very efficient in
identifying the cDNAs encoding novel secretory proteins with selective
expression in a specific subset of T lymphocytes, although the gene expression
in human Th1 lymphocytes, human Th2 lymphocytes, and activated human T
lymphocytes has been intensively analyzed. Our system is efficient in
discovering new secretory proteins, but it is impossible to detect all
secretory proteins. The reason is that some proteins translocate across the
endoplasmic reticulum (ER) membrane by posttranslational modification
(Deshaies et al. 1991;
Panzner et al. 1995), and that
some mitochondrial membrane proteins are synthesized on free polysomes,
released into cytosol, and transported across the organelle membrane by a
posttranslational mechanism.
We have succeeded in cloning the full-length cDNA of a novel gene (cluster
ID, Hs.182285) for which the product can be a transmembrane protein
induced in activated T lymphocytes. This molecule indeed exists at the plasma
membrane (Fig. 5B), and has
four predicted transmembrane domains and one WW domain (amino acids
8–34, also known as rsp5 or WWP) in accordance with PROSITE
(http://www.expasy.ch/prosite/).
The WW domain is one of the smallest, yet most versatile,
protein–protein interaction modules. The ability of this simple domain
to interact with a number of proline-containing ligands
(Chen and Sudol 1995), which
somewhat resembles SH3 (Src homology 3) domains,
has resulted in a great deal of functional diversity. Although it is difficult
to speculate the function of this molecule, this molecule may directly
activate or stabilize T lymphocytes, because WW domains can be found in many
signal transduction molecules.
In conclusion, the SAGE-based DNA microarray system described here
facilitates identification of the genes encoding novel secretory proteins for
which expression is regulated during biological processes in any type of cells
or tissues. Because subcellular fractionation by equilibrium
density–gradient centrifugation cannot discriminate perfectly secretory
proteins from nonsecretory proteins, the microsome fraction could contain
mRNAs for cytoplasmic proteins. However, the 3'-EST information revealed
by SAGE suffices full-length cDNA cloning, and the subcellular localization of
the molecules are predicted with considerable accuracy from the amino acid
sequence by using the algorithms such as SOSUI or PSORTII. Application of our
system to other cell types and conditions could lead to further identification
of the genes encoding novel secretory proteins that remain veiled in the human
genome (Velculescu et al.
1999; Sara et al.
2002).
|
METHODS
|
|---|
SAGE
The SAGE procedure was performed on mRNAs from human activated Th1
lymphocytes, activated Th2 lymphocytes, and resting CD4+ T
lymphocytes as described (Nagai et al.
2000). Sequenced files were analyzed with the SAGE software, SAGE
map
(http://www.ncbi.nlm.nlh.gov/SAGE/),
and NCBI's sequence search tool (advanced BLAST search;
http://www.ncbi.nlm.nih.gov/BLAST/).
After elimination of linker sequences and the repeated ditags, a total of
126,969 tags representing 32,219, 32,291, and 62,459 tags from activated Th1,
activated Th2, and resting CD4+ T lymphocytes, respectively, were
analyzed.
DNA Microarray Manufacture
We used 3' rapid amplification of cDNA ends method (3' RACE) to
collect cDNAs for the microarray analysis, using the RACE kit (Clontech)
according to the manufacture's instructions. The 3' RACE products were
cloned into the p-GEM T easy vector (Promega), and inserts of at
least two independent Escherichia coli clones were sequenced by using
a M13 forward primer. Sequence homology was confirmed by the advanced BLAST
search. For the analysis, we used 463 cDNA clones consisting of 150 genes
encoding cytoplasmic proteins, 229 genes encoding secretory proteins, 82 genes
with uncharacterized subcellular localization, and two negative controls
( [Takara] and tobacco chloroplast gene). Sequences of all
genes were verified. PCR products prepared from these clones were spotted onto
glass slides by using a robot with four printing tips (Kakengeneqs); length of
the amplicon ranged from 300–1000 bp. To normalized carrying
efficiencies of labeling and detection, a series of housekeeping genes
(encoding -actin, ribosomal protein L32, G3PDH, and thymocin 10)
and negative control genes ( and tobacco chloroplast gene)
were spotted in each of the four rectangles of DNA spots. The and
tobacco chloroplast gene that we used as negative controls have no
sequence homology to any sequence in the human genome.
Subcellular Fractionation
We used equilibrium density–gradient centrifugation to separate the
free ribosomes and the microsomes (Mechler
and Rabbitts 1981; Mueckler and
Pitot 1981; Mechler
1987). Briefly, PBMCs were cultured in RPMI1640 supplemented with
2 mM L-glutamine, 0.1 mM nonessential amino acids, 1 mM pyruvate, 5
x 10-5 mM 2-mercaptoethanol, and 10 % FCS containing 4 ng/mL
of IL-2 (R&D Systems) for 14 d. The cells were expanded from 2 x
107 to 3 x 108 cells. The cultured PBMCs were
further stimulated for 4 h with 50 ng/mL of PMA and 1 µg/mL of ionomycin
(Sigma). The 3 x 108 PBMCs were treated with cycloheximide
(50 µM; Sigma) for 10 min at 37°C and lysed hypotonically by using a
ball-bearing homogenizer followed by elimination of the nuclei by
centrifugating the homogenate at 2000g for 2 min at 4°C. The
supernatant containing cytoplasmic extract was diluted with 2.5 M sucrose
until the sucrose concentration reached 2.1 M and was layered on 2.5 M
sucrose. Two successive layers of sucrose solutions, one with 1.98 M sucrose
and the second with 1.3 M sucrose, were then layered over the sample. After
the gradients were centrifuged for 15 h at 90,000g and 4 °C, we
collected the free ribosomal fraction in load zone and the microsomal fraction
between the 1.98 M and 1.3 M sucrose layers.
RNA Isolation and Antisense RNA Amplification
Total RNA was isolated from the membrane and the cytoplasmic fraction by
using Trizol (Invitrogen). Poly (A)+ RNA was isolated from total RNA by using
oligo-dT30 (Roche Diagnostic System) according to the manufacturer's protocol.
Poly (A)+ RNA fractions recovered were amplified by using a linear T7-based
antisense RNA (aRNA)-amplification method. One fifth of resultant aRNA sample
was electrophoresed in 1% agarose gel, and the amount of aRNA was
quantitatively estimated by ethidium bromide staining. Thus, the amount of
aRNA to be used for the labeling procedure was adjusted.
Preparation of Fluorescence-Labeled cDNA and Microarray
Hybridization
aRNA from the cytoplasmic fraction was labeled with the fluorescent dye
Cy3; aRNA from the membrane fraction was labeled with the fluorescent dye Cy5.
The labeled probes were purified on Microcon 30 columns (Millipore), and 10
µg of yeast transfer RNA, 4 µg of poly (dA), and 15 µg of Cot1 human
DNA as blocking reagents were added to probes and concentrated to 12 µL.
Then, 2.55 µL of 20x standard saline citrate (SSC) and 0.45 µL of
10% sodium dodecyl sulfate (SDS) were added, and a final volume of 15 µL
was used as probe solution for hybridization on each cDNA-spotted slide. The
slides were covered with glass coverslips and fixed in a hybridization
cassette (TeleChem), and hybridization was performed for 12 h at 65 °C.
Glass slides were then washed in 2x SSC and 0.03% SDS for 5 min,
1x SSC for 5 min, and 0.2x SSC for 5 min.
Image Analysis
Fluorescent images of hybridized microarrays were obtained by using a
ScanArray 4000 (GSI Lumonics) and analyzed by using ScanAlyze 2 software
(http://rana.lbl.gov/EisenSoftware.htm).
Semiquantitative RT-PCR
Each total RNA (200 ng) was treated with DNase (Roche), and RT cDNA,
corresponding to 40 ng of total RNA, was amplified by PCR. Reaction mixtures
were incubated in a DNA Thermal Cycler (Perkin-Elmer) for 25–30
cycles.
Explanation of Box Plot
In each column, the genes for which Cy5/Cy3 ratios are from the 20th to
80th percentile are included in the box, and the genes for which Cy5/Cy3
ratios are from the 10th to 90th percentile are between the top and bottom
bar.
Full-Length cDNA Cloning of Hs.182285 cDNA
The human thymus marathon-ready cDNA (Clontech) was used to clone the
5' end of Hs.182285 cDNA by 5' RACE analysis. The first
PCR amplification was performed with ccatc ctaatacgactcactatagggc (adapter
primer 1) and aaaggggtc aatttgctctaatgtgtc (gene-specific primer 1): 32 cycles
for 20 s at 94°C and 3 min at 72°C, five cycles for 20 s at 94°C
and 3 min at 70°C, five cycles for 20 s at 94°C and 3 min at 68°C
x 22 cycles. The second (nested) amplification was performed with
actcactatagggctcgagcggc (adapter primer 2) and tgtcaaagacata ccacttacatgacgg
(gene specific primer 2): 27 cycles for 20 s at 94°C and 32 min at
72°C and five cycles for 20 s at 94°C and 3 min at 68°C x 22
cycles. PCR fragments were analyzed by agarose gel electrophoresis and
sequenced.
In Vitro Translation
The protein was synthesized from isolated plasmid Hs.7718 cDNA by
using the TNT in vitro transcription/translation system (Promega) in the
absence or the presence of canine pancreatic microsomal membranes (Promega).
Synthesized protein was detected by incorporation of [35S]
methionine (Amersham) as described by the manufacturer. Proteinase K treatment
of translation reactions was performed at final concentration of 50 µg/mL
for 1 h on ice in the presence or absence of 0.5% Triton X-100, followed by
inactivation of the protease with 3 mM phenylmethylsulfonyl fluoride. The
reactions were mixed with sample buffer and loaded onto SDS-PAGE (7.5%) gels.
Molecular mass standards were obtained from Bio-Rad.
Hs.182285 Gene Product–GFP Construct and Transient
Transfections
Hs.182285 gene product-GFP was obtained by PCR amplification of Hs.182285
open reading frame and cloned in the pEGFP-C1 and pEGFP-N2 vector (Clontech).
HEK293 cells were grown in Dulbecco's modified Eagle's medium supplemented
with 10% fetal bovine serum. pEGFP-C1/N2–Hs.182285 transfection was
carried out by using LipofectAMINE Plus (Invitrogen) according to the
instruction of the manufacturer.
Confocal-Scanning Laser Microscopy
Transfected cells were cultured on cover glass and fixed in 4% formaldehyde
in PBS for 15 min, and the membrane was labeled by DilC12 (Molecular Probe
Inc.). The specimens were examined with a laser-scanning confocal microscope
(Olympus).
|
Acknowledgements
|
|---|
This work was supported by CREST/SORST and Grant-in-Aid for Scientific
Research on Priority Areas (C) "Medical Genome Science" from the
Ministry of Education, Culture, Sports, Science and Technology of Japan.
The publication costs of this article were defrayed in part by payment of
page charges. This article must therefore be hereby marked
"advertisement" in accordance with 18 USC section 1734 solely to
indicate this fact.
|
Footnotes
|
|---|
Article and publication are at
http://www.genome.org/cgi/doi/10.1101/gr.709603.
3 Corresponding author.
E-MAIL
koujim{at}m.u-tokyo.ac.jp;
FAX 81-3-5684-2297. 
Article published online before print in June 2003.
|
REFERENCES
|
|---|
Chen, H.I. and Sudol, M. 1995. The WW domain of
Yes-associated protein binds a protein-rich ligand that differs from the
consensus established for Src homology 3–binding modules.
Proc. Natl. Acad. Sci.
17:
7819-7823.
Deshaies, R.J., Sanders, S.L., Feldheim, D.A., and Schekman, R.
1991. Assembly of yeast Sec proteins involved in translocation
into the endoplasmic reticulum into a membrane-bound multisubunit complex.
Nature 349:
806-808.[CrossRef][Medline]
Diehn, M., Eisen, M.B., Botstein, D., and Brown, P.O.
2000. Large-scale identification of secreted and
membrane-associated gene products using DNA microarrays. Nat.
Genet. 25:
58-62.[CrossRef][Medline]
Liang, P. and Pardee, A.B. 1992. Differential display
of eukaryotic messenger RNA by means of the polymerase chain reaction.
Science 257:
967-971.[Abstract/Free Full Text]
Mechler, B. and Rabbitts, T.H. 1981. Membrane-bound
ribosomes of myeloma cells, IV: mRNA complexity of free and membrane-bound
polysomes. J. Cell. Biol.
88: 29-36.[Abstract/Free Full Text]
Mechler, B.M. 1987. Isolation of messenger RNA from
membrane-bound polysomes. Methods Enzymol.
152:
241-248.[Medline]
Mueckler, M.M. and Pitot, H.C. 1981. Structure and
function of rat liver polysome populations, I: Complexity, frequency
distribution, and degree of uniqueness of free and membrane-bound polysomal
polyadenylate-containing RNA populations. J. Cell.
Biol. 90:
495-506.[Abstract/Free Full Text]
Nagai, S., Hashimoto, S., Yamashita, T., Toyoda, N., Satoh, T.,
Suzuki, T., and Matsushima, K. 2000. Comprehensive gene
expression profile of human activated Th1- and Th2-polarized cells.
Int. Immunol. 13:
367-376.
Nielsen, H., Engelbrecht, J., Brunak, S., and von Heijne, G.
1997. Identification of prokaryotic and eukaryotic signal
peptides and prediction of their cleavage sites. Protein
Eng. 10:
1-6.[Abstract/Free Full Text]
Panzner, S., Dreier, L., Hartmann, E., Kostka, S., and Rapoport,
T.A. 1995. Posttranslational protein transport in yeast
reconstituted with a purified complex of Sec proteins and Kar2p.
Cell 81:
561-570.[CrossRef][Medline]
Sara, S., Sparks, B.A., Rago, C., Akmaev, V., Wang, J.C.,
Vogelstein, B., Kinzler, W.K., and Velculescu, V.E. 2002. Using
the transcriptome of annotate the genome. Nature
Biotech. 19:
508-512.
Tashiro, K., Tada, H., Heilker, R., Shirozu, M., Nakano, T., and
Honjo, T. 1993. Signal sequence trap: A cloning strategy for
secreted proteins and type I membrane proteins.
Science 261:
600-603.[Abstract/Free Full Text]
Velculescu, V.E., Zhang, L., Vogelstein, B., and Kinzler, K.W.
1995. Serial analysis of gene expression.
Science 270:
484-487.[Abstract/Free Full Text]
Velculescu, V.E., Madden, S.L., Zhang, L., Lash, A.E., Yu, J.,
Rago, C., Lal, A., Wang, C.J., Beaudry, G.A., Ciriello, K.M., et al.
1999. Analysis of human transcriptomes. Nat.
Genet. 23:
387-388.[Medline]
|
WEB SITE REFERENCES
|
|---|
http://www.ncbi.nlm.nlh.gov/SAGE/;
National Center for Biotechnology Information SAGE database.
http://sosui.proteome.bio.tuat.ac.jp;
SOSUI algorithm.
http://psort.nibb.ac.jp/form2.html;
PSORTII algorithm.
http://www.expasy.ch/prosite/;
PROSITE.
http://www.ncbi.nlm.nih.gov/BLAST/;
advanced BLAST search.
http://rana.lbl.gov/EisenSoftware.htm;
ScanAlyze 2 software.
Received August 14, 2002;
accepted in revised format April 3, 2003.
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
H. Jaaro, Z. Levy, and M. Fainzilber
A Genome Wide Screening Approach for Membrane-targeted Proteins
Mol. Cell. Proteomics,
March 1, 2005;
4(3):
328 - 333.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
H. Hieronymus and P. A. Silver
A systems view of mRNP biology
Genes & Dev.,
December 1, 2004;
18(23):
2845 - 2860.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
ABSTRACT
RESULTS