Vol 13, Issue 2, 264-271, February 2003
LETTER
Systematic Discovery of New Genes in the Saccharomyces cerevisiae Genome
Marco M. Kessler,
Qiandong Zeng,
Sarah Hogan,
Robin Cook,
Arturo J. Morales1 and
Guillaume Cottarel
Genome Therapeutics Corporation,
Waltham, Massachusetts 02453, USA
 |
ABSTRACT
|
|---|
We used genome-wide comparative analysis of predicted protein
sequences to identify many novel small genes, named smORFs for
small open reading
frames, within the budding yeast genome. Further analysis
of 117 of these new genes showed that 84 are transcribed. We extended
our analysis of one smORF conserved from yeast to human. This
investigation provides an updated and comprehensive annotation of the
yeast genome, validates additional concepts in the study of genomes in
silico, and increases the expected numbers of coding sequences in a
genome with the corresponding impact on future functional genomics and
proteomics studies.
Current consensus suggests the number of yeast genes to
be very close to 6000 (Goffeau et al. 1996 ; Mewes et
al. 1997; Winzeler and Davis 1997). The number of protein-coding genes
with open reading frames (ORFs) longer than 100 codons is predicted to
be between 5300 and 5400 (Mackiewicz et al. 2002). Two recent studies
suggest that the determination of gene numbers by stringent gene
identification methods may underestimate the number of genes in human
and other organisms (Gopal et al. 2001; Reboul et al. 2001). The
initial annotation of the budding yeast genome did not include many
short open reading frames (ORFs; Andrade et al. 1997; Olivas et al.
1997). Recent experimental studies designed to catalog all genome
transcripts using SAGE technology (Velculescu et al. 1997; Basrai et
al. 1999) and the analysis of a collection of transposon insertions
(Ross-Macdonald et al. 1999) have discovered new ORFs that were not
previously identified in silico. This pool of genes includes some that
code for putative proteins that are shorter than 100 amino acids
(Velculescu et al. 1997; Basrai et al. 1999; Ross-Macdonald et al.
1999). Two recent studies described the use of comparative sequence
analysis between the genome of Saccharomyces cerevisiae
and those of other hemiascomycetous yeasts (Blandin et al. 2000) or
other Saccharomyces genomes (Cliften et al. 2001) to discover
small nonannotated protein-coding and nonprotein-coding genes in
chromosomal regions previously considered intergenic. In addition,
transposon insertion was recently used to identify yeast genes that
were previously overlooked (Kumar et al. 2002).
Here we describe a systematic in silico method to identify new small
genes in S. cerevisiae that is an extension of the searches
conducted by Blandin and Cliften (Blandin et al. 2000; Cliften et al.
2001) by using a more comprehensive database of fungal sequences. In
addition we provide a comprehensive demonstration that the majority of
the genes predicted are actually transcribed. Our findings from
comprehensive database searches and experimental studies suggest that
the number of coding genes in S. cerevisiae is substantially
higher than currently believed.
|
RESULTS
|
|---|
Identification of New ORFs
While comparing whole fungal genomes, we (Zeng et al. 2001) as well
as others (Kupfer et al. 1997; Tzung et al. 2001) made the observation
that fungal translated ORFeomes are very diverse. For example, many
S. cerevisiae proteins do not have homologs in Candida
albicans (Tzung et al. 2001). However, comparison of
S. cerevisiae predicted translated ORFs with a comprehensive
fungal database that includes predicted protein sequences from C.
albicans, Schizosacharomyces pombe, Aspergillus
nidulans and fumigatus, Cryptococcus neoformans,
Fusarium sporotrichioides, Neurospora crassa, and
Pneumocystis carinii suggests that most budding yeast
translated ORFs have homologs in one or more other fungal genomes (Zeng
et al. 2001). We used this observation to identify novel protein-coding
sequences in the budding yeast genome.
Our approach to identify candidate ORFs for new genes in the S.
cerevisiae genome is outlined in Figure
1. Briefly, we started with the S.
cerevisiae genomic sequence (12.07 mb total) and removed the
nucleotide sequences of the previously identified 6,224 coding ORFs
(Saccharomyces Genome Database, December 5 1997,
http://www.genome-www.stanford.edu/Saccharomyces). We then used the
remaining sequences (3.45 mb) to identify all stop-to-stop ORFs that
encode proteins with an arbitrary size of 18 amino acids or longer,
based on the observation in E. coli that the majority of genes
code for proteins with 18 or more amino acids (E. coli Genome
Center, University of Wisconsin, Madison.
http://www.genetics.wisc.edu/).
View larger version (25K):
[in this window]
[in a new window]
|
Figure 1. Overall strategy for smORF identification. Computational method used to
identify new ORFs not identified by conventional methods.
|
|
This approach resulted in approximately 140,000 predicted ORF products,
most of them shorter than 100 residues. These ORF products were next
searched against a comprehensive fungal protein sequence database to
identify those with potential homologs. This fungal database consists
of all NCBI entries listed under "fungi" (August 20, 2000,
excluding any S. cerevisiae sequences), plus the genomic
sequences from C. albicans (Stanford University) and A.
fumigatus (PathoGenome; http://www.LabOnWeb.com), EST sequences
from A. nidulans, C. neoformans, F.
sporotrichioides, and N. crassa (University of Oklahoma
Health Sciences Center), and P. carinii EST sequences
(University of Georgia). Using a cutoff score of
P  10–4 (this score was chosen because it is
reasonably stringent for short translated ORFs), we found 1057 S.
cerevisiae predicted ORF products with potential homologs in the
fungal database. ORFs were considered similar when the region of
sequence similarity between the small open
reading frame (smORF) and the predicted
protein(s) from our database extends over the entire coding region.
We then removed the ORFs which were annotated after 1997 and
while this work was in progress, those that overlap with rRNA, tRNA,
and Ty elements, and selected the smORFs with a start-to-stop ORF and
with an upstream in-frame stop. This approach resulted in 558 smORFs
that code for predicted proteins with potential fungal homologs and are
located in chromosomal sections previously identified as intergenic.
The 558 smORFs range in length from 18–190 codons with a mean of 64.99
codons, a median of 64 codons, and a mode of 62 codons. A unique aspect
of our search is that a comprehensive database of fungal genomic and
cDNA sequences was used in the sequence similarity searches as opposed
to the databases containing hemiascomycetous and Saccharomyces
species used in the studies of Blandin, Cliften, and coworkers (Blandin
et al. 2000; Cliften et al. 2001).
ORF Validation
We chose a subset of 117 smORFs for further characterization and
validation (Table 1). As a
first step we determined whether smORFs were expressed in yeast cells.
Primers were designed to amplify smORFs 2, 8, and 31 as well as the
ACT1 gene (actin) as control (see Methods), and used for
polymerase chain reaction (PCR) amplification with S.
cerevisiae genomic DNA as a template to test the PCR amplification
conditions. Products of the predicted size were obtained for all three
smORFs as well as the actin control (Fig.
2A, lanes 2,6,10,14). No
PCR products were obtained in reactions without the template (Fig. 2A,
lanes 1,5,9,13), or using as a template RNA isolated from S.
cerevisiae grown on rich (YPD) or complete synthetic minimal (CSM)
media (Fig. 2A, lanes 3,4,7,8,11, 12,15,16). This indicates that
these RNA samples were not contaminated with genomic DNA. We then
tested for the presence of RNA transcripts originating from these
smORFs as well as from the actin control, using RT-PCR. Products of the
expected sizes were obtained for actin, as well as all three smORFs
(Fig. 2B, lanes 2,3,5,6,8,9,11,12). This indicates that actin and the
three smORFs are indeed expressed in yeast cells grown in rich and in
minimal media. No RT-PCR product was obtained in reactions without a
template (Fig. 2B, lanes 1,4,7,10). The identity of the RT-PCR products
was confirmed by cloning them, followed by restriction mapping and
dideoxy sequencing (data not shown).
View larger version (239K):
[in this window]
[in a new window]
|
Figure 2. Experimental validation of the S. cerevisiae smORFs.
(A) Primers specific for the yeast ACT1 gene as well
as the three smORFs were used for PCR amplification using no template
(lanes 1,5,9,13), 50 ng genomic DNA
(lanes 2,6,10,14), 500 ng total RNA
from cells grown in rich media (lanes
3,7,11,15), and 500 ng total RNA
from cells grown in minimal media (lanes
4,8,12,16) .(B) Primers
specific for the yeast ACT1 gene as well as the three smORFs
were used for RT-PCR amplification using no template (lanes
1,4,7,10), 500 ng total RNA from
cells grown in rich media (lanes
2,5,8,11), and 500 ng total RNA
from cells grown in minimal media (lanes
3,6,9,12). PCR and RT-PCR products
were fractionated on a 1% agarose gel with DNA size markers and
visualized after ethidium bromide staining. Sizes of DNA fragments in
bp are indicated. (C) Two-step orientation-specific RT-PCR.
Primers whose sequence is complementary to the predicted mRNAs of
smORF2, 8, and 31 were used for first-strand cDNA synthesis. After heat
inactivation of the reverse transcriptase, PCR amplification was
carried out with both smORF-specific primers (lanes
5,6,11,12,17,18).
As control, the experiment was repeated using primers with the same
sequence as the mRNA for first-strand cDNA synthesis (lanes
3,4,9,10,15,16).
(D) Examples of RT-PCR results with various smORFs indicated
on top. RT-PCR detection of transcripts from the annotated smORFs
YLL018C-A and YHR132W-A are shown. smORFs for which RT-PCR reactions
resulted in no products are indicated (*) as are those for which the
product is not of the expected size ( ). These smORFs were not
included in Table 1. Sizes of DNA fragments in bp are indicated.
(E) Transcript size determination by Northern analysis of the
ACT1 (lane 3), smORF2 (lane 5), and smORF31 (lane
7). Unlabeled RNA markers stained with methylene blue (lane
1) and labeled RNA markers (lanes
2,4,6) were fractionated together with yeast
poly (A)+ RNA. Sizes are shown in nucleotides.
|
|
We then wanted to make sure that the smORF transcripts we identified
were transcribed from the predicted DNA strand. To do this, we
performed a variation of the RT-PCR experiment, first adding a primer
complementary to the predicted mRNA and the reverse transcriptase.
After first-strand cDNA synthesis, the reverse transcriptase was
inactivated with heat and then Taq polymerase and both smORF-specific
primers were added (Fig. 2C). Under these conditions we observed PCR
products only when first-strand synthesis was conducted with primers
complementary to the predicted mRNA (Fig. 2C, lanes 5,6,11,12,17,18).
No PCR product was observed when first-strand synthesis was done with
primers that have the same sequence as the mRNA (lanes 3,4,9,10,15,16).
These results indicate that the transcripts observed for smORFs 2, 8,
and 31 are made from the predicted strand.
This same study was extended to 114 additional smORFs. RT-PCR products
of the expected size were obtained for 81 of these smORFs (e.g., Fig.
2D). Therefore, 84 of the 117 smORFs are transcribed from the predicted
DNA strand (Table 1). The codon adaptation index (CAI,
http://www.molbio.oc.ac.uk) was calculated for the 84 smORFs (Table 1),
and they range from 0.045–0.282. Similar values were obtained for
the 6224 annotated yeast genes. Nine of the smORFs in this list were
recently annotated by Blandin, Cliften, and coworkers (Blandin et
al. 2000; Cliften et al. 2001). We originally found SR12 downstream of
the AST1gene, which was recently reannotated and extended, and
now includes SR12 (Saccharomyces Genome Database, 2001;
http://www.genome-www.stanford.edu/Saccharomyces). In addition we
also identified smORF 68 and had an RT-PCR product for it. This smORF
maps to YCL057C-A, which was recently removed from the
Saccharomyces Genome Database (Saccharomyces Genome Database,
2001; http://www.genome-www.stanford.edu/Saccharomyces). The
majority of the smORFs were found only once in the budding yeast
genome, except for SR15, which is present four times in chromosome 12,
downstream of ASP3, in a 3.6-kb repeat region of this
chromosome (Johnston et al. 1997). Even though we detected
an RT-PCR product for this smORF, we do not know which copy was
transcribed. To address the possibility that the observed smORF
transcripts were products of read-through transcription from genes
located upstream of the smORFs, the RT-PCR experiment was conducted
using a primer complementary to the mRNA for first-strand synthesis
(Fig. 2C) and with a second primer located 400 base pairs (bp) upstream
of the smORF. With these conditions, no RT-PCR products were observed
for 25 smORFs tested, indicating that the smORF transcripts are not the
result of read-through transcription from upstream genes (data not
shown). To confirm these observations, we measured the size of the
transcripts coded for by smORFs 2, 31, and the ACT1 gene using
Northern analysis (Fig. 2E). The size of the ACT1 mRNA was
1300 nucleotides (nt; lane 3). The mRNAs for both smORF2 and 31 have a
measured size of 460 nt (Fig. 2E, lanes 5,7), in agreement with a size
predicted for a 250-nt ORF, a 20–30-nt 5' untranslated region (Hughes
et al. 2000), a 100-nt 3' untranslated region (Graber et al. 2002), and
a poly (A) tail of 70–90-nt (Hector et al. 2002). Northern analysis of
smORF2 transcripts shows a band of 780 nt that could correspond
to alternative processing variants. It is unlikely that this band
represents read-through from the gene located upstream of smORF2
(SNR56), because it is located 1700 bp upstream. This
results indicate that the observed transcripts originate in the
promoter of the smORFs.
Characterization of smORF2
We now present a comprehensive analysis of smORF2, as homologs
of this protein (smORF2p) are found in many organisms from yeast
to humans (Fig. 3), and its deletion from
S. cerevisiae exhibits a tractable phenotype. The human,
Caenorhabditis elegans, Drosophila melanogaster,
and S. pombe smORF2p homologs are about the same size as
the S. cerevisiae counterpart. smORF2 was recently
annotated by Blandin and coworkers (2000) with the systematic name
YBL071W-A.
View larger version (28K):
[in this window]
[in a new window]
|
Figure 3. Multiple sequence alignments for smORF2p. smORF2p has highly conserved
homologs in other fungi and in mammalian species. Abbreviations: Dm,
Drosophila melanogaster; Hs, Homo sapiens; Ce,
Caenorhabditis elegans; Sc, Saccharomyces cerevisiae;
Ca, Candida albicans; Af, Aspergillus fumigatus; An,
Aspergillus nidulans; Sp, Schizosaccharomyces pombe;
Bt, Bos taurus; Mm, Mus musculus. Residues that are
identical or similar in all protein homologs are shaded in black, and
those identical or similar in two or more, but not all, proteins in the
alignment are shaded in gray. Homology shading was done with GeneDoc
(Nicholas et al. 1997).
|
|
We extended our study of smORF2p to determine whether we could detect a
protein product of the appropriate size. A triple HA tag was fused to
the C-terminus of smORF2 by PCR, and the wild-type smORF2 gene was
replaced with the tagged version by allele replacement into the
chromosome (Ederniz et al. 1997). PCR amplification of the smORF2
(HA)3 gene from genomic DNA, followed by cloning and
sequencing, confirmed the identity of the tagged smORF2. Soluble
extracts were then prepared and fractionated in 18% polyacrylamide
gels containing sodium dodecyl sulfate. The proteins were
transferred to a poly (vinylidene) fluoride (PVDF) membrane,
and the blot was probed with anti-HA antibodies. The results show a
protein band corresponding to a 9-kD protein (Fig.
4, lanes 3,4) in extracts prepared from
cells with a tagged smORF2 gene and not in wild-type cells. This
result shows that smORF2 is not only transcribed, but also encodes a
detectable protein product of the expected size.
View larger version (41K):
[in this window]
[in a new window]
|
Figure 4. smORF2 is expressed in yeast. A triple HA tag was fused to the
C-terminal end of smORF2 using PCR, and the wild-type smORF2 gene was
replaced by the tagged smORF2 gene by allele replacement into the
chromosome. Soluble extracts were prepared and analyzed in a Western
blot probed with monoclonal antibodies that recognize the HA epitope.
Extracts from wild-type cells (lane 2) and extracts from two
separate isolates carrying the HA-tagged smORF2 (lanes
3,4).
|
|
We then extended our study of smORF2 to determine whether this gene
is essential or whether its deletion results in an observable
phenotype. The complete smORF2 gene was deleted in a diploid yeast
strain, using homologous recombination. Sporulation and tetrad
analysis showed that haploid strains with a smorf2 were
able to grow at 30°C (slow growth), but not at 37°C (Fig.
5). To extend the notion of smORF to
humans, we next tested whether the human smORF2 is a functional homolog
of the yeast smORF2. The human smORF2 gene, obtained from an EST
clone, and the yeast smORF2 were cloned into the pYES vector for
expression in yeast under the GAL1 promoter. Clones were
verified by sequencing and transformed into the smorf2
strain. The resultant transformants were tested for the ability to
complement the temperature-sensitive phenotype of the
smorf2 strain and their ability to form colonies at the
restrictive temperature. The results show that the cloned human smORF2
as well as the yeast smORF2 can complement the temperature-sensitive
phenotype of the smorf2 strain (Fig. 5). These results
indicate that the human smORF2 is a functional ortholog of the yeast
smORF2. Interestingly, the human smORF2 maps to two loci in the human
genome, one in chromosome 3 where the gene contains two introns and
codes for a predicted mRNA identical to the EST, and to a locus in
chromosome 20 without introns but with nine predicted amino acid
substitutions. These data indicate that small ORFs are present and
expressed in humans, and they underscore the importance of looking for
small genes in the genomes of higher eukaryotes.
|
DISCUSSION
|
|---|
We have validated a method for gene identification in sequenced
genomes and used it to identify new genes in S. cerevisiae.
With this method one should be able to find new coding ORFs in S.
cerevisiae by simply searching potential budding yeast ORF products
against sequences from other fungal and nonfungal species. Even though
we did not verify the expression of every predicted smORF, we found
strong evidence for close to 100 new genes in the S.
cerevisiae genome. The limited study reported here can be expanded
to include smORFs that partially overlap with annotated ORFs and smORFs
that are completely located within previously annotated ORFs as
described recently by Kumar et al. (2002). This systematic genome
comparison approach to identify ORFs will accelerate and refine genome
annotation and gene identification and will impact future experimental
design. The identification of conserved protein products across a wide
range of species can provide us with the opportunity to use S.
cerevisiae and other fungi to study the function of their
counterparts in humans. In addition, our approach can be applied to
other sequenced genomes including human in order to identify coding
ORFs not readily detected by conventional methods. We anticipate
finding additional smORFs which do not yet have a homolog as the amount
of available sequence data increases. Conversely, we will miss some
smORFs that are species-specific and therefore have no homologs in
other species. We refer to these species-specific smORFs as orphan
smORFs. This study and others involved in gene discovery will change
the landscape of genome annotation and therefore the approach in
experimental design.
|
METHODS
|
|---|
RT-PCR Analysis
Genomic DNA was prepared from strain W303 (Thomas and Rothstein
1989) using the YeaStar Genomic DNA kit (Zymo Research). Primers pairs
were chosen to amplify 250–300-bp regions within the coding ORFs of
the yeast ACT1 gene (5'-TGTCACCAACTGGGACGATA-3';
5'-AACCAGCGTAAATTGGAACG-3'), smORF2 (5'-TGACGAAATCGAAATCGAAG-3';
5'-GATGCCTGCCTCTTCGTAGT-3'), smORF8 (5'-TG CCTAAGAGATTAAGTGGGTT-3';
5'-CGTCAGTTCAGGGT GTGAAA-3'), smORF31
(5'-TGTCTGCATTATTTAATTTTC GTTC-3'; 5'-AGCTGTTAAATTGACTGATGGC-3').
RNA was isolated from 5 x 107 yeast cells (strain W303)
growing exponentially in YEPD or synthetic complete synthetic minimal
media using the RNeasy Mini kit from QIAGEN including a DNase
(Roche) digestion step. RT-PCR reactions were done with the OneStep
RT-PCR Kit from QIAGEN as recommended by the manufacturer. RT-PCR
products were fractionated on a 1% agarose gel and visualized after
ethidium bromide staining. For sequencing, the RT-PCR products were
isolated from an agarose gel and then cloned into pCR2.1-TOPO
(Invitrogen). To test expression of the 117 smORFs, primers were chosen
within the coding sequence to amplify fragments of 25 bp or
longer.
Strand-Specific RT-PCR Analysis
First-strand ynthesis was conducted using yeast RNA, primers as
indicated, and SuperScript II reverse transcriptase (Life Technologies)
as recommended by the manufacturer. PCR amplification was conducted
using PCR SuperMix (Life Technologies), smORF-specific primers, and
8.5% of the first-strand reaction.
For Northern analysis, 0.8 µg yeast poly (A)+ RNA together with
DIG-labeled and unlabeled RNA markers (Invitrogen) were fractionated in
1.5% formaldehyde-agarose gel as recommended (Ambion), transferred to
Nylon membrane, and probed with single-stranded antisense probes
against ACT1 (Fig. 2E, lanes 2,3), smORF2 (lanes 4,5), and
smORF31 (lanes 6,7) labeled with DIG-UTP and detected as recommended
(Roche).
Epitope Tagging
The modified smORF2 (HA)3 was constructed by two-way PCR.
First, a PCR amplification was made using a primer corresponding to
400 bp upstream of smORF2 (5'-AGAAAGCCCTCAAGCTTTCCCAGCG) and a second
primer containing the C-terminus of smORF2 fused to the HA
tag
(5'-GGAGCCTGATCCAGCGTAGTCTGGGACGTCG TATGGGTAGCCAGCGTAGTCTGGGACGTCGT ATGGGTAGCCAGCGTAATCCGGAACATCATAC GGGTATCCTACGGCAGCAGCGGCAATAGGCTCAGG-3').
A second amplification was carried out with a forward primer containing
the tag
(5'-GTAGGATACCCGTATGATGTTCCG GATTACGCTGGCTACCCATACGACGTCCCAG ACTACGCTGGCTACCCATACGACGTCCCAGA CTACGCTGGATCAGGCTCCTAAAGATGAGAG GCTAGATCGAG-3')
and a primer located downstream of smORF2
(5'-TGTCGCTTTTTCTCCTCGATGAAGC CAAGCGCCGAACCAATTGATATCATCGGCACG-3').
The tagged smORF2 gene was introduced into the smORF2 locus by allele
replacement (Ederniz et al. 1997). Allele replacement was first checked
by PCR and then verified by PCR amplification of the tagged gene,
cloning into pCR2.1-TOPO (Invitrogen) and sequencing.
S100 extracts were prepared from diploid W303 yeast cells grown in 25
mL of rich medium (YPD) to mid-log phase as described (Brown
et al. 1996). Immunoblots were probed with a 1:1000 dilution of the
16B12 monoclonal antibody (Berkeley Antibody) against
HA3-tagged proteins.
Gene Disruption
smORF2 was disrupted in the diploid W303. Cells were transformed
with a PCR fragment containing the HIS3 marker flanked by 400
bp of smORF2 sequences. The HIS3 sequences replaced amino
acids 1 to 82 of smORF2. Histidine prototrophs were selected, and PCR
was used to verify correct genomic integration. Sporulation and tetrad
analysis were as described (Guthrie and Fink 1991). The human smORF2
coding sequence was amplified from I.M.A.G.E. clone 1047404 (Research
Genetics). The yeast smORF2 was amplified from genomic DNA. PCR
fragments were cloned into pYES2.1/V5-His-TOPO (Invitrogen) and
transformed into yeast as described (Guthrie and Fink 1991).
|
WEB SITE REFERENCES
|
|---|
http://www.LabOnWeb.com; Aspergillus fumigatus genomic
sequences are available on the Web.
http://www.genetics.wisc.edu/; Escherichia coli Genome Center.
October 13, 1998, revision date: E. coli Genome Center,
University of Wisconsin, Madison.
http://genome-www.stanford.edu/Saccharomyces/; Saccharomyces Genome
Database as of December 5 1997.
http://genome-www.stanford.edu/Saccharomyces/; Saccharomyces Genome
Database as of October 2001.
http://www.molbio.oc.ac.uk; Codon adaptation index (CAI).
|
NOTE ADDED IN PROOF
|
|---|
While this paper was in being reviewed, Fichtner and Schaffrath
reported the isolation of the KTI11 gene by complementation of
zymocin-resistant yeast mutants. Kti11p is smORF2. (Fichtner, L. and
Schaffrath R. 2002. KTI11 and KTI13, Saccharomyces cerevisiae genes
controlling sensitivity to G1 arrest induced by Kluyveromyces lactis
zymocin. Mol. Microbiol. 44: 865–875.)
|
Acknowledgements
|
|---|
We thank Kim Fechtel for valuable suggestions and for critical
reading of the manuscript.
The publication costs of this
article were defrayed in part by payment of page charges. This article
must therefore be hereby marked "advertisement" in accordance with
18 USC section 1734 solely to indicate this fact.
|
Footnotes
|
|---|
1 Corresponding author. 
E-MAIL arturo.morales{at}genomecorp.com; FAX (781) 398-2476.
Article and publication are at
http://www.genome.org/cgi/doi/10.1101/gr.232903.
|
REFERENCES
|
|---|
Andrade, M.A., Daruvar, A., Casari, G., Schneider, R., Termier, M., and Sander, C. 1997. Characterization of new proteins found by analysis of short open reading frames from the full yeast genome. Yeast 13: 1363-1374.[CrossRef][Medline]
Basrai, M.A., Velculescu, V.E., Kinzler, K.W., and Hieter, P. 1999. NORF5/HUG1 is a component of the MEC1-mediated checkpoint response to DNA damage and replication arrest in Saccharomyces cerevisiae. Mol. Cell. Biol. 19: 7041-7049.[Abstract/Free Full Text]
Blandin, G., Durrens, P., Tekaia, F., Aigle, M., Bolotin-Fukuhara, M., Bon, E., Casaregola, S., de Montigny, J., Gaillardin, C., Lepingle, A., et al. 2000. Genomic exploration of the hemiascomycetous yeasts: 4. The genome of Saccharomyces cerevisiae revisited. FEBS Lett. 487: 31-36.[CrossRef][Medline]
Brown, C.E., Tarun, S.Z., Jr., Boeck, R., and Sachs, A. 1996. PAN3 encodes a subunit of the Pab1p-dependent poly(A) nuclease in Saccharomyces cerevisiae. Mol. Cell. Biol 16: 5744-5753.[Abstract]
Cliften, P.F., Hillier, L.W., Fulton, L., Graves, T., Miner, T., Gish, W.R., Waterston, R.H., and Johnston, M. 2001. Surveying Saccharomyces genomes to identify functional elements by comparative DNA sequence analysis. Genome Res. 11: 1175-1186.[Abstract/Free Full Text]
Erdeniz, N., Mortensen, U.H., and Rothstein, R. 1997. Cloning-free PCR-based allele replacement methods. Genome Res. 7: 1174-1183.[Abstract/Free Full Text]
Goffeau, A., Barrell, B.G., Bussey, H., Davis, R.W., Dujon, B., Feldmann, H., Galibert, F., Hoheisel, J.D., Jacq, C., Johnston, M., et al. 1996. Life with 6000 genes. Science 274: 546-567.[Abstract/Free Full Text]
Gopal, S., Schroeder, M., Pieper, U., Sczyrba, A., Aytekin-Kurban, G., Bekiranov, S., Fajardo, J.E., Eswar, N., Sanchez, R., Sali, A., et al. 2001. Homology-based annotation yields 1,042 new candidate genes in the Drosophila melanogaster genome. Nat. Genet. 27: 337-340.[CrossRef][Medline]
Graber, J.H., McAllister, G.D., and Smith, T.F. 2002. Probabilistic prediction of Saccharomyces cerevisiae mRNA 3'-processing sites. Nucleic Acids Res. 30: 1851-1858.[Abstract/Free Full Text]
C. Guthrie, G.R. Fink, M.I. Simon & J.N. Abelson, 1991. Guide to yeast genetics and molecular biology. Methods Enzymol. Academic Press, New York, NY.
Hector, R.E., Nykamp, K.R., Dheur, S., Anderson, J.T., Non, P.J., Urbinati, C.R., Wilson, S.M., Minvielle-Sebastia, L., and Swanson, M.S. 2002. Dual requirement for yeast hnRNP Nab2p in mRNA poly(A) tail length control and nuclear export. EMBO J. 21: 1800-1810.[CrossRef][Medline]
Hughes, J.D., Estep, P.W., Tavazoie, S., and Church, G.M. 2000. Computational identification of cis-regulatory elements associated with groups of functionally related genes in Saccharomyces cerevisiae. J. Mol. Biol. 296: 1205-1214.[CrossRef][Medline]
Johnston, M., Hillier, L., Riles, L., Albermann, K., Andre, B., Ansorge, W., Benes, V., Bruckner, M., Delius, H., Dubois, E., et al. 1997. The nucleotide sequence of Saccharomyces cerevisiae chromosome XII. Nature 387: 87-90.[Medline]
Kumar, A., Harrison, P.M., Cheung, K.H., Lan, N., Echols, N., Bertone, P., Miller, P., Gerstein, M.B., and Snyder, M. 2002. An integrated approach for finding overlooked genes in yeast. Nat. Biotechnol. 20: 58-63.[CrossRef][Medline]
Kupfer, D.M., Reece, C.A., Clifton, S.W., Roe, B.A., and Prade, R.A. 1997. Multicellular ascomycetous fungal genomes contain more than 8000 genes. Fungal Genet. Biol. 21: 364-372.[CrossRef][Medline]
Mackiewicz, P., Kowalczuk, M., Mackiewicz, D., Nowicka, A., Dudkiewicz, M., Laszkiewicz, A., Dudek, M.R., and Cebrat, S. 2002. How many protein-coding genes are there in the Saccharomyces cerevisiae genome? Yeast 19: 619-629.[CrossRef][Medline]
Mewes, H.W., Albermann, K., Bahr, M., Frishman, D., Gleissner, A., Hani, J., Heumann, K., Kleine, K., Maierl, A., Oliver, S.G., et al. 1997. Overview of the yeast genome. Nature 387: 7-65.[Medline]
Nicholas, K.B., Nicholas, H.B., Jr., and Deerfield, D.W., II 1997. GeneDoc: Analysis and visualization of genetic variation. EMBnet News 4: 14-17.. http://www.no.embnet.org/embnet.news/vol4_2/contents.html.
Olivas, W.M., Muhlrad, D., and Parker, R. 1997. Analysis of the yeast genome: Identification of new noncoding and small ORF-containing RNAs. Nucleic Acids Res. 25: 4619-4625.[Abstract/Free Full Text]
Reboul, J., Vaglio, P., Tzellas, N., Thierry-Mieg, N., Moore, T., Jackson, C., Shin-I, T., Kohara, Y., Thierry-Mieg, D., Thierry-Mieg, J., et al. 2001. Open-reading-frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nat. Genet. 27: 332-336.[CrossRef][Medline]
Ross-Macdonald, P., Coelho, P.S., Roemer, T., Agarwal, S., Kumar, A., Jansen, R., Cheung, K.H., Sheehan, A., Symoniatis, D., Umansky, L., et al. 1999. Large-scale analysis of the yeast genome by transposon tagging and gene disruption. Nature 402: 413-418.[CrossRef][Medline]
Thomas, B.J. and Rothstein, R. 1989. The genetic control of direct-repeat recombination in Saccharomyces: The effect of rad52 and rad1 on mitotic recombination at GAL10, a transcriptionally regulated gene. Genetics 123: 725-738.[Abstract/Free Full Text]
Tzung, K.W., Williams, R.M., Scherer, S., Federspiel, N., Jones, T., Hansen, N., Bivolarevic, V., Huizar, L., Komp, C., Surzycki, R., et al. 2001. Genomic evidence for a complete sexual cycle in Candida albicans. Proc. Natl. Acad. Sci. 98: 3249-3253.[Abstract/Free Full Text]
Velculescu, V.E., Zhang, L., Zhou, W., Vogelstein, J., Basrai, M.A., Bassett, D.E., Jr., Hieter, P., Vogelstein, B., and Kinzler, K.W. 1997. Characterization of the yeast transcriptome. Cell 88: 243-251.[CrossRef][Medline]
Winzeler, E.A. and Davis, R.W. 1997. Functional analysis of the yeast genome. Curr. Opin. Genet. Dev. 7: 771-776.[CrossRef][Medline]
Zeng, Q., Morales, A., and Cottarel, G. 2001. Fungi and humans: Closer than you think. Trends Genet. 17: 682-684.[CrossRef][Medline]
Received March 1, 2002;
accepted in revised format November 7, 2002.
13:264-271 © by 2003 Cold Spring Harbor Laboratory Press ISSN 1088-9051/03 $5.00
 CiteULike  Connotea  Del.icio.us  Digg  Reddit  Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
L. Pena-Castillo and T. R. Hughes
Why Are There Still Over 1000 Uncharacterized Yeast Genes?
Genetics,
May 1, 2007;
176(1):
7 - 14.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Sopko and B. Andrews
Small open reading frames: Not so small anymore.
Genome Res.,
March 1, 2006;
16(3):
314 - 315.
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. P. Kastenmayer, L. Ni, A. Chu, L. E. Kitchen, W.-C. Au, H. Yang, C. D. Carter, D. Wheeler, R. W. Davis, J. D. Boeke, et al.
Functional genomics of genes with small open reading frames (sORFs) in S. cerevisiae.
Genome Res.,
March 1, 2006;
16(3):
365 - 373.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. M. Gelperin, M. A. White, M. L. Wilkinson, Y. Kon, L. A. Kung, K. J. Wise, N. Lopez-Hoyo, L. Jiang, S. Piccirillo, H. Yu, et al.
Biochemical and genetic analysis of the yeast proteome with a movable ORF collection
Genes & Dev.,
December 1, 2005;
19(23):
2816 - 2826.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. E. Cusick, N. Klitgord, M. Vidal, and D. E. Hill
Interactome: gateway into systems biology
Hum. Mol. Genet.,
October 15, 2005;
14(suppl_2):
R171 - R181.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
S. Steigele and K. Nieselt
Open reading frames provide a rich pool of potential natural antisense transcripts in fungal genomes
Nucleic Acids Res.,
September 7, 2005;
33(16):
5034 - 5044.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
D. M. Kupfer, S. D. Drabenstot, K. L. Buchanan, H. Lai, H. Zhu, D. W. Dyer, B. A. Roe, and J. W. Murphy
Introns and Splicing Elements of Five Diverse Fungi
Eukaryot. Cell,
October 1, 2004;
3(5):
1088 - 1100.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
V. Castelli, J.-M. Aury, O. Jaillon, P. Wincker, C. Clepet, M. Menard, C. Cruaud, F. Quetier, C. Scarpelli, V. Schachter, et al.
Whole Genome Sequence Comparisons and "Full-Length" cDNA Sequences: A Combined Approach to Evaluate and Improve Arabidopsis Genome Annotation
Genome Res.,
March 1, 2004;
14(3):
406 - 413.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. M. Porcel, O. Delfour, V. Castelli, V. De Berardinis, L. Friedlander, C. Cruaud, A. Ureta-Vidal, C. Scarpelli, P. Wincker, V. Schachter, et al.
Numerous Novel Annotations of the Human Genome Sequence Supported by a 5'-End-Enriched cDNA Collection
Genome Res.,
March 1, 2004;
14(3):
463 - 471.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
ABSTRACT
RESULTS