INTRODUCTION

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION METHODS REFERENCES

Potato virus A (PVA) belongs to Potyviridae (genus Potyvirus), the largest virus family infecting plants (Shukla et al. 1994; Urcuqui-Inchima et al. 2001). The PVA genome is composed of a messenger-polarity ssRNA of 9565 to 9572 nt including a 3'-poly(A) tail and a virus-encoded protein (VPg) covalently attached to the 5'-end (Kekarainen et al. 1999; Oruetxebarria et al. 2001). Each end contains a nontranslated region (NTR). The genome encodes a polyprotein that is cleaved into mature proteins via the action of three viral proteinases: P1, HC-Pro, and NIa-Pro (Dougherty and Semler 1993).

All genomic regions and mature proteins of potyviruses are involved in genome amplification (Haldeman-Cahill et al. 1998; Urcuqui-Inchima et al. 2001). The current information regarding potyviral protein function has accumulated mainly from a number of independent studies employing traditional mutagenesis methods (substitutions, deletions, and insertions) on individual proteins, protein-encoding regions, or NTRs in different potyviruses. These strategies are time-consuming and somewhat limited in potyviruses given the genome's large size and a lack of unique restriction sites. The entire potyviral genome has not yet been systematically investigated, except for a study including 19 mutant cDNA clones of Tobacco vein mottling virus, each containing a 12-nt insertion (Klein et al. 1994). Consequently, large regions of the potyviral genome remain to be studied.

We describe here a rapid functional analysis of a complete PVA genome. Our approach is based on the phage Mu in vitro DNA transposition reaction (Savilahti et al. 1995; Haapa et al. 1999a). Following transposition and processing of the reaction intermediates, the resultant viral mutants are inoculated into protoplasts for propagation. Subsequent PCR-based genetic footprinting analysis is used to map genomic regions that are essential/nonessential for virus propagation (Fig. 1). The mutagenesis strategy resulted in a library of PVA mutants, each containing a single 15-bp insertion. The mutated loci were distributed throughout the genome, and 1125 insertions were detected by autoradiography following denaturing polyacrylamide gel electrophoresis. Analysis of the mutants after selection for virus propagation in protoplasts revealed many previously unidentified regions in the PVA genome that are essential for virus propagation. Additionally, many positions in the viral genome tolerated insertions without a detectable effect on virus propagation. Thus, a highly saturated map of essential and nonessential genomic sites was obtained. Subsequent tests on several individual virus mutants in plants demonstrate that the mutant library will also be useful for future studies on various other stages of viral infection at the whole-plant level.

View larger version (20K): [in this window] [in a new window]   Figure 1     Schematic presentation of the steps involved in generation and analysis of the insertion mutant library of PVA resulting in a functional map of the genome. pPVA, the infectious cDNA plasmid of PVA.

	RESULTS

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION METHODS REFERENCES

Generation and Characterization of a 15-bp Insertion Mutant Library

The full-length PVA genome cloned as DNA in a plasmid vector, pPVA, can be used to initiate viral infection (Puurand et al. 1996). To generate an insertion mutant library we first subjected this plasmid to an in vitro DNA transposition reaction catalysed by the phage Mu transposase. Transposition products were nick-translated with DNA polymerase I, digested with NotI, and ligated to produce the mutant clone library (Fig. 2). The resultant library (pPVA-Mu) included approximately 75,000 independent plasmid clones.

View larger version (18K): [in this window] [in a new window]   Figure 2     Generation of 15-bp insertion library. (A) A tetramer of MuA transposase (small circles) assembles a DNA transposition complex with a pair of modified (containing NotI site) Mu genome R end-specific DNA segments (dashed line). The complex next executes the transposition reaction by which the Mu end segments are attached to the target plasmid molecules at variable positions, creating a staggered cut. The linear two-ended transposition reaction products are isolated, and gapped reaction products are then processed with DNA polymerase I, digested with NotI, and self-ligated to produce a pool of plasmids with a 15-bp insertion. During the process, 5 bp of the target site is duplicated. (B) The amino acid sequence encoded by the 15-bp insertion (bold type) varies depending on the insertion reading frame. No wild-type amino acids are mutated or deleted and no stop codon is formed. An example of insertions into the coat protein-coding region of PVA is shown. Genomic positions are indicated both by nucleotides and amino acids (numbers). Duplicated target sites are underlined.

Comparative restriction analysis verified the presence of inserts in the library (Fig. 3). NotI digestion did not linearize the original wild-type clone but completely linearized the mutant pool of plasmids. Furthermore, codigestion of the library with SphI, which alone linearized the wild-type clone, produced a smear indicating that a number of different sized restriction fragments were produced. Thus, NotI sites in the library were distributed throughout the plasmid sequence, and virtually all of the DNA molecules in the insertion library contained the predicted NotI site-containing insertion.

View larger version (51K): [in this window] [in a new window]   Figure 3     Restriction analysis of pPVA and pPVA-Mu plasmid pools. (A) Plasmid map of pPVA and predicted map of pPVA-Mu are shown. Arrows indicate inserted NotI sites in different molecules. (B) Plasmids were digested with enzymes and analyzed by electrophoresis on a 1.8% TBE gel parallel to nondigested (nc) plasmids. pPVA and pPVA-Mu are denoted as `W' and `I,' respectively. Migration of circular (C) and linear (L) plasmid forms are indicated.

Fine-Mapping of Insertion Sites at the Nucleotide Level and Validation of the Strategy

Ten base pairs in each of the insertion-containing plasmids were derived from the transposon-specific sequence (Fig. 2). This common sequence allowed us to use PCR-based strategies to localize insertion sites. Overlapping genome segments were first amplified with PVA-specific primers, and each PCR product was subsequently used to map the insertion sites by a combination of linear and exponential DNA amplification strategies (Fig. 4, Methods section).

View larger version (12K): [in this window] [in a new window]   Figure 4     PCR-based footprinting strategy used in fine mapping of insertion sites. Primers are indicated by arrows, insertion sites by triangles, and labeled products by asterisks. Primer INS1: 5'-TATACTCTTCAGATGCGGCCG, with insertion-specific nucleotides underlined. A, B, and C are PVA-specific primers.

To establish the validity of our approach, we first analyzed a segment spanning the PVA genome region between nt 5152 and nt 6375. This segment was amplified from both pPVA-Mu and pPVA, the latter serving as a negative control. Amplified segments were then subjected to insertion-specific PCR analysis using different primer combinations, and the reaction products were analyzed by denaturing polyacrylamide gel electrophoresis and autoradiography (Fig. 5). The pPVA-Mu generated a distinctive band pattern (lanes 1, 3, 5) that was not produced with pPVA (lanes 2, 4, 6). The same band pattern was generated from both 3'- and 5'-labeled amplified molecules (lanes 1 and 3). Furthermore, PVA-specific primers that hybridize to the PVA genome at 14-nt intervals produced identical patterns with a difference corresponding to 14 nt in their electrophoretic mobility (lanes 3 and 5). These data indicated that insertion clones specifically and reproducibly produced amplification products from the library, and that the methodology could be used to reliably map the insertion sites.

View larger version (22K): [in this window] [in a new window]   Figure 5     Specificity of amplification. A genome segment of pPVA (W) and pPVA-Mu (I) spanning the region between nt 5152 and nt 6375 was subjected to insertion-specific amplification reactions with the primer pairs INS1/FO12R (FO12R: 5'-AGCCTGATATCAGTATAGGGACTC) and INS1/FO13R (FO13R: 5'-ATAGGGACTCTCATCTAGTGTGTAC). Products from the former reaction were radioactively labeled with the primer INS2 (INS2: 5'-TATACTCTTCAGATGCGGCCGCA, with insertion-specific nucleotides underlined) or FO12R. Products from the latter reaction were labeled with the primer FO13R. Insertions and primers are illustrated by triangles and arrows, respectively. The radioactive labels are indicated by asterisks. (A) Labeled products were separated by urea-PAGE gel. Numbers to the right refer to the band pattern in lane 5 and indicate the positions of insertions in the PVA genome. Sample numbers are indicated below each lane.

Selection for Propagation and Genetic Footprinting

Functional analysis of genome regions can be obtained by the use of comparative parallel analysis of insertion mutant pools. One such method, genetic footprinting, is based on subjecting a mutant pool to selective conditions and subsequently comparing the selected mutants to the input mutant population. We subjected the PVA insertion mutant pool to selection for virus propagation in plant cells by transfecting the pPVA-Mu plasmid library into tobacco protoplasts. After two days of virus propagation, immunocapture with monoclonal antibodies against the virus coat protein was used to collect a sample for viral cDNA synthesis and subsequent genome segment amplification (the sample included mature virions encapsidating viral RNA). The genome segment from the selected pool was then subjected to insertion-specific PCR and gel analysis (as above). The corresponding amplified fragment from pPVA-Mu prior to selection was used for comparison. Bands missing in the selected pool (compared to the unselected pool) indicated that insertions into those positions were not tolerated during viral propagation. To confirm reproducibility, we produced footprinting patterns from two independent inoculations (Methods section, protoplast pools I and II). Patterns along a 200-nt stretch of interest were essentially identical (data not shown), indicating that the protoplasts were efficiently inoculated and that the identification of the essential sites was accurate and reproducible.

We studied the whole virus genome by first amplifying 11 overlapping fragments (1.1 to 1.3 kb each). Genome analysis was facilitated by the use of 75 PVA-specific labeling primers located at ~200-bp intervals. The overall strategy yielded overlapping band patterns, and thus about 42% of the genome was analyzed twice. An example of the analysis is shown in Figure 6. Many of the insertion-specific amplification products were generated with both the selected and unselected pools. However, a number of the products obtained from the unselected pool were not generated from the selected pool, clearly indicating positions of deleterious insertions. In rare cases, a product was detected only in the selected pool (e.g., a product generated with primer FO10R and indicating an insertion at the genomic site 6125 in Fig. 6B). These products probably indicated mutants that were represented at low numbers in the pPVA-Mu library but which propagated in protoplasts to detectable levels. A total of 1125 essentially randomly distributed insertion sites were detected in the 9565-nt PVA genome at an average interval of 8 nt. Some insertions were detected at adjacent nucleotide positions, whereas others were more distant. The largest interval was 62 nt. A total of 329 sites were found to be essential for production of mature virions, since these sites were not detected in the selected genome pool.

View larger version (23K): [in this window] [in a new window]   Figure 6     Collection and analysis of footprinting data. (A) Insertion-specific amplification from the genome segment spanning the region between nt 5152 and nt 6375 was performed using the primer pairs INS1/FO10R (FO10R: 5'-ATTCAACCGACTCTTTCTTCTGTG) and INS1/FO11R (FO11R: 5'-TTCTTCTGTGGTAGTTCAGCATAGT). The products were labeled as indicated by asterisks. (B) The labeled reaction products were analyzed by urea-PAGE. The patterns generated from pPVA-Mu before and after selection for replication in protoplasts are indicated by `I' and `P,' respectively. The patterns from the wild-type clone (pPVA) are indicated by `W.' Genomic location numbers (as in Fig. 5) refer to products labeled with FO10R. Arrows highlight insertions that are missing after selection. Labeling primers are indicated on the top of the gel, and sample numbers are given below each lane.

Regions of the PVA Genome Essential and Nonessential for Virus Propagation

The insertions that specify genomic locations either essential or nonessential for PVA propagation are summarized in Table 1, and their distribution along genomic regions is illustrated in Figure 7. A specification of known functional characteristics of potyviral proteins and genome segments can be found in recent reviews (Shukla et al. 1994; Revers et al. 1999; Urcuqui-Inchima et al. 2001).

View larger version (52K): [in this window] [in a new window]   Figure 7     Functional map of the PVA genome. A typical PVA virion visualized by ISEM and a schematic map of the PVA polyprotein are shown at the top. For functions of the various genomic regions, see Table 1. The genomic sites nonessential (N) and essential (E) for viral genome replication and encapsidation are indicated by the bars protruding upwards and downwards, respectively, from the horizontal lines depicting the various genomic regions of PVA. The positions of the genomic regions are indicated by their first and last nucleotide (nt) or amino acid (aa). The oligonucleotides 61475 and 4141 are complementary to the 5'-proximal nucleotides of the 5'-NTR and the 3'-proximal nucleotides of the 3'-NTR, respectively, of the PVA genome, and insertions within these genomic regions could not be detected.

5'-NTR

P1 Region

HC-Pro Region

P3 Region

CI Region

The 6K1 and 6K2 Regions

VPg Region

NIa-Pro Region

NIb Region

CP Region

3'-NTR

Analysis of Individual Insertion Mutants

We selected several independent insertion mutant clones from the pPVA-Mu library to test their individual infectivity in protoplasts and plants. Seven mutants not detected after selection en masse in protoplasts were tested first, and none of them was infectious in protoplasts, as expected (data not shown). Other mutants containing an insertion at different proteins (HC-Pro, P3 (two mutants), CI, NIa-Pro, NIb, or CP) and which were detected after selection en masse, as well as two mutants (insertion in P1 or VPg) that had not been detected in the pPVA-Mu library by footprinting analysis (because low signals were disregarded), were also tested. Following protoplast inoculation, three mutants containing an insertion in P1, HC-Pro, or P3 propagated and accumulated CP antigen to levels detectable by ELISA, in contrast to the other mutants tested. Tobacco plants were systemically infected only with the mutant containing an insertion in P1 and one of the two mutants containing an insertion in P3. Insertions were detected by RT-PCR and subsequent digestion of the PCR product with NotI in the progeny viruses so as to indicate that the mutants had not reverted to wild-type in the systemically infected leaves. Electron microscopy revealed PVA virions of a similar size in the protoplasts infected with the three infectious mutants and the wild-type PVA (data not shown).

These results show that mutants that were actually able to propagate alone in protoplasts were fewer in number than those detected in the genetic footprinting analysis, due most likely to in trans complementation by other mutants during the en masse selection. The mutant containing an insertion in HC-Pro could infect protoplasts but caused no detectable infection in leaves, due presumably to impaired viral genome amplification and/or cell-to-cell movement. Infection of protoplasts by viruses may be less constrained than infection of cells in their natural intercellular context in leaf tissues, because many resistance responses induced by virus infection in leaves and whole plants are not similarly expressed in protoplasts (Chivasa et al. 1997). The insertion in HC-Pro was at a site previously unknown with respect to its functional significance. Taken together, these data demonstrate the potential of the pPVA-Mu library for studies on virus infection at the whole-plant level.

	DISCUSSION

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION METHODS REFERENCES

We used a Mu in vitro DNA transposition-based strategy to generate a large, genome-wide insertion mutant library for a plant-infecting potyvirus, PVA. Mutants were selected for their ability to propagate in protoplasts and form virus particles, and then screened en masse to map the genomic sites essential for viral propagation. This strategy allowed the efficient examination of genomic regions never before studied for their importance in viral genome amplification.

A total of 1125 essentially randomly distributed insertions were mapped within the PVA genome. Thus, the pPVA-Mu library provided a unique strategy to study functional genomics of the entire PVA genome. Insertions mapped to previously studied genomic regions revealed that a wealth of our pPVA-Mu mutant results are consistent with previous data obtained with fundamentally different methods, thus validating our approach with respect to identifying essential and nonessential sites in the viral genome. A total of 329 PVA mutants were not recovered from protoplasts into which the mutant library was inoculated for propagation, revealing hundreds of essential, previously unknown sites in the potyvirus genome. Further examination of these sites will be the focus of future studies.

An overview of the functional map of the PVA genome constructed in this study (Fig. 7) reveals several interesting features. One of them is the striking difference in the tolerance of short insertions in the 5'- and the 3'-NTRs. Low tolerance of insertions in the 5'-NTR may indicate that insertion mutants possibly contain more stable RNA structures due to the palindromic sequence in the insertion, which may interfere with the initiation of translation. Alternatively, the mutants may be defective in virus assembly (Johansen and Morrow 2000) beginning from near the 5'-terminus of the potyviral genome (Wu and Shaw 1998) and therefore excluded in immunocapture-RT-PCR. Some insertions at the core region of the CP might also have interfered with virus assembly, resulting in exclusion of the mutants from footprinting analyses. The high tolerance of 3'-NTR to short insertions is consistent with the view that only a few predictable, stable secondary structures are important to infectivity in the potyviral 3'-NTR (Haldeman-Cahill et al. 1998).

Another interesting feature is the distribution of the essential sites in the protein-encoding regions of PVA (Fig. 7). A few insertions representing sites essential for propagation were typically located next to each other, followed by tens of codons tolerant of insertions. These data provide confidence that the insertions do, in fact, pinpoint essential sites. Such information will be helpful for future investigation of protein function in large proteins such as P3 that are poorly understood. In our analysis, 33 of the total of 135 insertions in P3 were deleterious. The positions of 22 deleterious insertions matched exactly with, or were one or two nucleotides apart from, the codons for amino acid residues highly conserved among potyviruses (Shukla et al. 1994) and/or identical between PVA and Potato Y potyvirus (data not shown). Taken together, these findings provide validation of the resultant map of essential sites in the PVA genome (Fig. 7).

On the other hand, several protein-encoding regions such as P1, P3, NIa-Pro, and CP contain large regions tolerant of the short insertions. Potyvirus genomes tend to be recalcitrant to insertion of foreign sequences, and identification of suitable insertions sites is particularly cumbersome (German-Retana et al. 1999; Choi et al. 2000). Therefore, data from this study may be helpful for engineering PVA-based gene vectors for expression of foreign peptides or viral proteins with novel epitopes or tags in plants. The tests on tobacco plants performed with two PVA mutants containing an insertion in P1 or P3 showed that they were fully infectious, inducing systemic infection similar to that of wild-type PVA.

In some cases, our results differed from the data obtained using traditional mutagenesis methods in that an insertion within a protein domain known to be important for virus propagation was not deleterious. The most likely explanation for such discrepancies is the fact that the Mu transposition system used does not substitute or delete any amino acid residues, and the original amino acids were retained in the mutated virus. Several insertional mutagenesis studies indicate that insertions do not always perturb protein function (Manoil and Bailey 1997; Nelson et al. 1997; Neuveglise et al. 1998; Laurent et al. 2000). Another explanation may be that in trans complementation (e.g., Li and Carrington 1995) between two viral genomes carrying insertions at different positions and coinfecting protoplasts might mask mutant phenotypes and interfere with detection of certain essential sites. Successful propagation of some insertion mutants during en masse selection and their failure to do so when inoculated to protoplasts one by one (Table 2) is consistent with this possibility. Thus, many of the essential sites mapped in this study by en masse selection probably represent those that cannot be complemented in trans.

PCR-based footprinting strategies have been used to map insertion sites efficiently in a relatively short genome region (Smith et al. 1995; Singh et al. 1997; Laurent et al. 2000), but the current strategies are not practical for the analysis of long molecules, for example, complete viral genomes. For the analysis of short insertions throughout the whole genome of PVA, we therefore designed a strategy that used a 21-nt primer (INS1) including eight nucleotides complementary to the inserted sequence at the 3'-end and a stretch of 13 nucleotides at the 5'-end which hybridized neither to the viral sequence nor the insert. This primer was used under optimized conditions together with PVA-specific oligonucleotides to map insertions throughout the pPVA-Mu insertion library before and after selection in protoplasts. This footprinting strategy is efficient for the analysis of insertion sites in large plasmids or complete genomes because it is not affected by insertions located outside the region of interest in other molecules present in the mutant pool. Furthermore, a low insertion frequency at any given region does not disturb the analysis.

The number of PVA mutants obtained in this study is remarkable, and the insertion mapping and mutant selection strategies employed yielded information on ~12 % of all possible sites. However, the Mu integration target site selection is relatively flexible (Haapa et al. 1999a; Haapa-Paananen et al., 2002) and, consequently, the analyzed mutants represent only a fraction of the total number of different mutants present in the library. Indeed, we could isolate individual mutants (pM14 and pM25; Table 2) that were not detected by our footprinting analysis. Although most of the DNA phosphodiester bonds can serve as effective targets for Mu transposition, some of the bonds are preferred to others (Haapa-Paananen et al. 2002). Consequently, the resultant mutant library inevitably contains the representative clones in different numbers, allowing our footprinting assay to identify only those mutant clones that are present in numbers above a certain threshold level. Analysis of additional mutants using the type of assay chosen for our study would require lowering the threshold; for example, by using more cycles in PCR and/or accepting weaker signals.

Besides Mu (Haapa et al. 1999a,b; Laurent et al. 2000), several other in vitro transposition-based methods have been developed for use as tools for molecular biology applications. These methods include bacterial transposons Tn552 (Griffin et al. 1999), Tn7 (Gwinn et al. 1997), and Tn5 (York et al. 1998), the yeast retrotransposon Ty1 (Devine and Boeke 1994), MoMLV retroviral integrase (Singh et al. 1997), and the eukaryotic mariner element Himar 1 (Akerley et al. 1998). Since these diverse systems function similarly, it may be feasible to use them in a manner analogous to our study. The Mu transposon tool is composed of only a few components and utilizes highly efficient, accurate, and essentially random in vitro DNA transposition (Haapa et al. 1999a). The system has enabled us to map many novel sites essential for virus propagation in PVA. Furthermore, this study provides novel data for future studies on protein structure-function relationships in potyviruses. The pPVA-Mu library is a valuable source of specific insertion mutants that can be studied in more detail to characterize the functional domains of different proteins in virus propagation, movement, virion assembly, or for engineering PVA for vector purposes. This is the first study in which an entire virus genome, rather than a genome segment (Laurent et al., 2000), has been mutagenized using an in vitro DNA transposition system and the mutants analyzed using a genetic footprinting technique. Furthermore, the strategy described is applicable to any cloned DNA.

	METHODS

TOP ABSTRACT INTRODUCTION RESULTS DISCUSSION METHODS REFERENCES

Molecular Biology Techniques, Proteins, and Reagents

Standard DNA techniques were used as described (Sambrook et al. 1989). Plasmids, PCR products, and RNA were purified using appropriate purification kits from QIAGEN. The infectious plasmid pPVA (Puurand et al. 1996), containing the PVA-B11 genome (EMBL database accession no. AJ296311) under the control of Cauliflower mosaic virus 35S promoter, was further purified by CsCl gradient centrifugation. Phage Mu transposase (MuA) was purchased from Finnzymes and Taq DNA polymerase from Fermentas. DNA polymerase I (Pol I), T4 DNA polynucleotide kinase (PNK), restriction endonucleases, and the random hexanucleotide mixture (dN)₆ were purchased from Promega. T4 DNA ligase and SuperscriptII reverse transcriptase were from Life Technologies, and [-³³P]-ATP from NEN Life Science Products. All reagents were used under the reaction conditions recommended by the supplier unless otherwise indicated.

In Vitro DNA Transposition Reaction, Processing of Reaction Products, and Electrotransformation

Mu-specific donor DNA segment was produced from the oligonucleotides TK7650 (5'-GTTTTCGCATTTATCGTGAA ACGCTTTCGCGTTTTTCGTGCGCGGCCGCA) and TK7651 (5'-TGCGGCCGCGCACGAAAAACGCGAAAGCGTTTCAC GATAAATGCGAAAAC) by annealing as described (Savilahti et al. 1995). Standard in vitro DNA transposition reactions (50 µL) contained 1320 ng (40 pmol) donor DNA segment, 1670 ng pPVA DNA (0.19 pmol), 8.7 µg MuA (107 pmol), 25 mM Tris-HCl, pH 8.0, 100 µg/mL BSA, 15% (w/v) glycerol, 0.05 % (w/v) Triton X-100, 126 mM NaCl, and 10 mM MgCl₂. Reactions were performed at 30°C for 1h 15 min and stopped by freezing in liquid nitrogen. Reaction products were analyzed by electrophoresis on a 1.8% SeaPlaque agarose (BMA) gel in 1× TAE buffer as described (Savilahti et al. 1995). Linear reaction products from a total of 16 transposition reactions were first recovered by electroelution from the gel and then purified by sequential phenol and chloroform extractions, followed by precipitation with ethanol and resuspension in TE-buffer (10 mM Tris-HCl, pH7.5; 0.5 mM EDTA). The product was then subjected to a nick-translation reaction (100 µL) containing ~2 µg DNA, 5 mM dNTPs, and 9 U Pol I. The reaction was performed at 37°C for 1h 10 min after which the reaction products were purified as above. The DNA was then shortened by digestion with NotI and isolated using the anion exchange column Gen-Pak FAX (Waters) and ethanol precipitation. Plasmid molecules were then recircularized by ligation at a low DNA concentration (~1 ng/µL) to favor intramolecular ligation. Ligated DNA (600 ng) was purified as above and resuspended in 10 µL of water. Aliquots (1 µL) were electroporated with Genepulser II (BioRad) into 40 µL of E. coli XL1-Blue MRF' electroporation-competent cells (Stratagene). Transformed cells were selected using Luria medium (LB) with ampicillin (100 µg/mL) at 37°C, after which the plasmid DNA (pPVA-Mu) was isolated.

Protoplast Preparation, Electroporation, and Immunocapture of Virions

Protoplasts were prepared from leaves of in vitro-grown plants of Nicotiana tabacum cv. Samsun and electroporated as described (Denecke et al. 1989) using a BioRad Genepulser II. A total of 17 protoplast batches (200 µL, 1 × 10⁶ protoplasts) were electroporated with pPVA-Mu (10 µg) linearized with AgeI. Each batch was then cultured separately in daylight at room temperature for 48 h, after which protoplasts were pelleted by centrifugation (Denecke et al. 1989). Supernatants were removed and protoplasts resuspended in 100 µL of ELISA buffer (Clark and Adams 1977) and disrupted with a syringe by passing them through a needle (gauge 0.9 mm) several times. The absence of intact protoplasts was confirmed by light microscopy. To confirm PVA infection in each protoplast batch, half of the disrupted protoplast sample was analyzed by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using a monoclonal antibody (Mab) 58/0 (Adgen) that detects an epitope at the N-terminus of PVA CP (Rajamäki et al. 1998). From the remaining half of the sample, virions were trapped to a microcentrifuge tube with MAb 58/0, followed by reverse transcription (RT) (final vol. 50 µL) of the viral RNA released from virions using Superscript II reverse transcriptase and random hexamers as recommended by the manufacturer. This method, coined as immunocapture-RT-PCR, is described elsewhere (Nolasco et al. 1993). After the RT reactions, the viral cDNA from four and 13 protoplast batches was pooled (pools I and II, respectively), and the pools were used for footprinting analysis.

Genetic Footprinting

The overall strategy used in genetic footprinting is illustrated in Figure 4. Eleven overlapping genomic segments (~1.1 to 1.3 kb each) were first amplified by PCR using appropriate pairs of PVA-specific oligonucleotides (Table 3). Ten nanograms of plasmid DNA (pPVA or pPVA-Mu) or three microliters of the cDNA obtained from immunocaptured virions was used as template. The reaction (50 µL) was initially heated for 1 min at 95°C, after which 28 cycles of amplification were performed for 1 min at 95°C, 1 min at the estimated optimal annealing temperature of the oligonucleotide pairs (Birren et al. 1997), and 1 min at 72°C. Each PCR product was then purified, and 50 ng of DNA was used as a template for insertion-specific PCR amplification (50 µL). This amplification was initiated using INS1 primer, and after five cycles of linear amplification (1 min at 95°C, 1 min at 45°C, and 1 min at 72°C) a PVA-specific primer was added and 10 more cycles of amplification were performed (1 min at 95°C, 1 min at 58-64°C depending on the oligonucleotide, and 1 min at 72°C). PCR products were purified and equivalent amounts were labeled using the appropriate PVA-specific primer 5' end-labeled with [³³-P] ATP and PNK. Ten pmol of labeled oligonucleotide was used in a 25µL labeling-amplification reaction (5 cycles with 25 sec at 95°C, 25 sec at optimal annealing temperature of the labeled oligonucleotide used, and 30 sec at 72°C). The reaction was analyzed using 7 M urea-6% polyacrylamide gel electrophoresis. Visualization/quantitation of the reaction products was performed on a Phosphorimager (Molecular Dynamics) using the ImageQuant program (Molecular Dynamics). Only those band intensity values from the unselected pool that exceeded those of the selected pool by at least a factor of five were considered indicative of deleterious sites. In practice, only clear bands that were missing in the comparison lane were included in the data set. Rarely, control reactions (with pPVA) produced a few nonspecific bands that led to rejection of the corresponding band in the pPVA-Mu footprinting analysis. A few signals were more obvious in the selected sample than in the unselected sample, but they were not studied further.

Insertion Mutants: Isolation, Protoplast Inoculation, Electron Microscopy, and Plant Inoculation

The exact positions of the insertion sites were determined for nine individual plasmid clones by DNA sequence analysis using the appropriate primers, ThermoSequenase kit (Amersham), and ALF DNA Sequencer (Pharmacia). Each plasmid was linearized using AgeI, electroporated into tobacco protoplasts, and the protoplast tested for PVA infection by DAS-ELISA as described above. Virions were studied using immunosorbent electron microscopy (ISEM) using anti-PVA CP MAbs (mixture of MAb 58/0 and MAb 58/6; Rajamäki et al. 1998) as described (Roberts and Harrison 1979). They were visualized with a transmission electron microscope (Philips CM12) at 16-24 × 10³-fold magnification at the Wood Ultrastructure Research Centre, SLU.

Linearized plasmids were also used to coat microprojectiles that were subsequently bombarded into the first full-grown true leaves of four-week-old tobacco plants by one or two shots using a Helios Gene Gun (Bio-Rad) as described (Hämäläinen et al. 2000; Kekarainen and Valkonen 2000). The tobacco plants were grown in a growth chamber (photoperiod 18 h, light intensity 250 µEs¹m², temperature 19°/17°C day/night, relative humidity 40%). PVA infection was detected in inoculated and upper noninoculated leaves by DAS-ELISA 15 days after bombardment as described (Rajamäki et al. 1998). Total RNA was purified from systemically infected tobacco leaves and cDNA synthesized (reaction volume 20 µL) using Superscript II reverse transcriptase and random hexamers (Life Technologies). One microliter of each cDNA preparation was used in PCR to amplify the regions containing the insertions. PCR products were digested with NotI and analyzed by electrophoresis on a 2% agarose gel in TBE buffer for verification of the insertion in each clone.