|
|
|
|
Vol. 10, Issue 9, 1381-1392, September 2000
LETTER
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| |
ABSTRACT |
|---|
|
|
|---|
We have taken a computational approach to the problem of discovering and deciphering the grammar and syntax of gene regulation in eukaryotes. A logical first step is to produce an annotated catalog of all regulatory sites in a given genome. Likely candidates for such sites are direct and indirect repeats, including three subcategories of indirect repeats: inverted (palindromic), everted, and mirror-image repeats. To that end we have produced a searchable database of inverted repeats of chromosomes III and X of Caenorhabditis elegans, the first completely sequenced multicellular eukaryote. Initial results from the use of this catalog are observations concerning odd/even biases in perfect IRs. The potential usefulness of the catalog as a discovery tool for promoters was shown for some of the genes involved with G-protein functions and for heat shock protein 104 (hsp104).
| |
INTRODUCTION |
|---|
|
|
|---|
The completion of the genome sequence of Caenorhabditis
elegans marks the beginning of what is likely to be
years of database mining of this genome for the
purpose of cataloging, organizing, and interpreting actual or putative
regulatory motifs by which this multicellular eukaryote coordinates the
development and maintenance of differentiation (Clarke and Berg 1998
;
Goffeau 1998
; Brown 1999
). The choice of which motifs or types of
motifs to search for can be guided in part by the wealth of laboratory
research on gene regulation in Drosophila,
Caenorhabditis, Strongylocentrotus, and various
mammals, as well as the unicellular eukaryote Saccharomyces. That is, a starting place for any search of likely regulatory motifs is
to seek ones similar to those already identified in these model organisms.
Transcription profiling has helped to focus some genome-wide studies
such as Roth et al. (1998)
and van Helden et al. (1998)
, both of which
looked for conserved motifs ~600-800 bp upstream of well-analyzed
assemblages of co-regulated genes in Saccharomyces. Both study
groups were optimistic that their search algorithms had found some (but
not necessarily all) previously known regulatory motifs and had
discovered likely new motifs. Numerous other studies of model
multicellular eukaryotes, such as Drosophila and
Caenorhabditis, have revealed many conserved regulatory motifs
and these have been widely used in chromosome and genome-wide searches
(e.g., Wong et al. 1985
).
Upon publication of the complete Caenorhabditis genome, an
analysis of IRs, as well as other repetitive sequences, was carried out
(C. elegans Sequencing Consortium 1998
). In that study,
inverted repeats (IRs) up to 2000 bp in length with loops of any size
within the 2000-bp range were searched for. IRs of that description
were found in 3.6% of the Caenorhabditis genome but were most
densely clustered on the autosomal arms. Furthermore, a
disproportionate number of IRs were found within genes, presumably as
parts of introns. Frontali and Pizzi (1999)
analyzed recurring patterns of short oligonucleotides of introns and intergenic regions of Caenorhabditis chromosome III and found those areas to be repetitive.
Our initial focus on IRs was based on their known functions in three
different types of regulatory mechanism: (1) Some IRs are symmetrical
sites for the binding of regulatory factors, especially dimeric factors
such as leucine zippers. (2) Some IRs provide opportunities for
distinctive internal basepairing and regulation in RNAs. (3) Some IRs
use transposon-like mechanisms to rearrange and regulate genes, and
transposons themselves are likely to have been the origin for some
regulatory sequences (Britten 1997
).
We have produced a web-based, searchable, annotated catalog for Caenorhabditis chromosomes III and X comprising all possible IRs of sizes ranging from 20-200 bp with 0-10% mismatches in the stems and non-base-paired loops of up to one-third the length of the IR. The database may be accessed through queries based on size, location, or sequence. Each IR is identified in respect to location, nearest downstream gene, frequency, similar sequences, and links to the Caenorhabditis genome project. Furthermore, there is a selectable option to show a graphical representation of any IR, internally base paired with the minimum number of mismatches.
The constraints of the search were such that it is unlikely that the
results show functional transposons, which tend to be hundreds to
thousands of base-pairs long with terminal IRs representing a small
fraction of sequence, if present at all. Our limit on loop size
would exclude most typical transposons. Even MITES (miniature inverted
repeat transposable elements) which are abundant in
Caenorhabditis and are in the low hundreds of base pairs long
are probably not represented in most of the data reported here
(Surzycki and Belknap 2000
). An exception might be IRs at the high end
of the range, about 200 bp long with loops of 60 bp or more, placing
them within boundaries of some MITES. (Inverted repeats of that length
are available for viewing at the web site but were not the focus of this analysis.)
Moderately repetitive microsatellites (2-5 bp) and minisatellites
(~15 bp), as well as highly repetitive satellites (5-100 bp),
are tandemly repeated sequences, some of which appear to propagate
themselves by uneven crossovers or replication slippage (as defined
in Charlesworth et al. 1994
). Some satellite repeats are found
associated with or as parts of IRs, as well as in typical tandem
arrays. In general the functions of satellite repeats are not well
defined or understood. However, in some cases, such as in
promoters for heat shock genes, repetitive satellite-like sequences of heat shock elements (HSEs) seem to be important for transcription (e.g., Wiederrecht et al. 1987
). Thus, although many smaller
satellite repeats are below the limits of detection for this
study, the ones that were revealed may be of potential interest as
regulators. A case in point is the promoter region of the gene for
hsp104 described in this paper.
| |
RESULTS |
|---|
|
|
|---|
Short Inverted Repeats Show Specific Biases for Odd or Even Lengths
Tables 1 and 2 show the totals
of all non-AT-rich, perfect IRs from length 4-60 bp on chromosomes III
and X, along with a list of randomly generated IRs of the same lengths.
"AT-rich" and "CG-rich" are defined here as any sequences
composed exclusively of As and Ts or Cs and Gs, respectively. All IRs
have been unnested, which means that only counts of unique sequences
are shown. Only IRs without loops in the middle were counted. In both
chromosomes, for lengths 5-19 Bp there is a strong bias toward odd
lengths, which is strikingly different from the randomly generated
sequences of the same length.
|
|
The odd number biases described may well continue for lengths greater than 25 bp; however this would not be reflected in the greatly reduced sample size for longer sequences. Note that a certain amount of odd-number bias is also seen in the random data due to our definition of odds as being perfect, although, in fact, they were allowed a wild card of any base at the middle position. The experimental data show a greater bias, especially for lengths over 9 bp, for which there are many more perfect repeats than what would be expected from random combinations.
Tables 1 and 2 also show the totals of all AT-rich IRs. This is contrasted with the sums of all CG-rich inverted repeats. Here there is a pronounced even bias for AT-rich IRs of 20-60 bp on chromosome III (18-60 on X), Although there is no particular bias for CG-rich repeats and, indeed, there are relatively few of those. For lengths greater than 30 bp on chromosome III, there are no odd lengths of AT-rich IRs and only one on chromosome X after length 25 bp.
Table 3 compares genic and intergenic sequences of
4-25 bp. In general, and for both chromosomes, the biases described
above are still evident after this rearrangement of the data. However, decreasing sample size at greater lengths prevents simple
extrapolation of these trends. Intergenic non-AT-rich repeats
represent 40-70% of chromosome III and 58-74% of X. For AT-rich
repeats, 50-78% are intergenic on chromosome III and 54-69% on X. However, the two chromosomes are not directly comparable in that a
smaller proportion of chromosome III is composed of intergenic regions.
|
Repeats Are Either Evenly Distributed Across Chromosomes or Are More Prevalent on the Chromosome Arms
Perfect repeats of sizes 4-30 bp were examined in respect to their distribution on chromosomes III and X. Also repeats composed exclusively of A and T were analyzed separately. For both chromosomes, all repeats of 4-9 bp were distributed evenly. At increasing lengths the repeats of chromosome III were found to be more abundant on the arms forming a bowl-shaped distribution. The distribution for chromosome X was more even and only slightly bowl-shaped. The AT-rich sequences of chromosome III were more abundant on the arms with a bowl-shaped distribution, becoming more marked at greater lengths (15-30 bp). The AT-rich sequences of chromosome X were fairly evenly distributed, with only slight bias toward the arms. However, spikes of AT-rich repeats interrupted the even distribution on the X, indicating clusters of very AT-rich sequence.
Several Clusters of Inverted Repeats of 25-60 bp Are Highly Conserved and Contain Known Conserved Motifs
Perfect IRs of >25 bp have a strong possibility of being biologically significant and therefore are worth investigating further. There are no IRs >25 bp generated from random sequence. The presence of IRs of those lengths and greater on chromosomes III and X suggests that they are the result of evolutionary selection and conservation. In particular, Table 1 shows at least two anomalous clusters of non-AT-rich perfect IRs: 30 bp and 46 bp, as well as about 8 other perfect, loopless IRs between 25 and 60 bp.
In order to show the usefulness of this software and graphical display
as a discovery tool for promoters, some repeats were selected for
additional analysis. For the two largest anomalous clusters in
chromosome III (30 bp and 46 bp), conserved motifs were searched by
compiling a list of all the nucleotide strings 5 bp, in proximity to
the pivot points of the IRs, and then querying the literature as to
whether any were published motifs. Three motifs were found, one of
which, GTGAC, was chosen for further detailed analysis (Tables
4,5).
|
|
Table 4 lists all 12 intergenic repeats containing GTGAC, a sequence
that binds estrogen receptor and AP-1 factor in mammals, sometimes as a
palindrome (Weisz and Rosales 1990
). The motif has not been reported
previously in Caenorhabditis. Note that the only perfect
lengths that contain this motif are 46, 44, 38, 30, 28, 26, and 25 bp
and that those sequences are distributed fairly evenly across the 13 million bp length of chromosome III. It is remarkable that all
non-AT-rich, 46-bp perfect IRs on chromosome III are identical. The following
is half of the sequence of the repeat. (See also Fig. 1.)
|
ATGTATTTAAATACATTTGTGAC
Furthermore, subsets of this sequence are conserved in the shorter IRs containing GTGAC.
In Table 5, the ten IRs with a GTGAC motif, which are found within genes, are listed. These also have a conserved full-length sequence, but unlike their intergenic counterparts, most are clustered within genes located between about 2.5-6.5 million bp on chromosome III.
Because all the perfect IRs of length 46 were identical and contained the GTGAC motif, we looked at irregular IRs (with GTGAC) of that length for up to 10% mismatches on the stem, including loops of up to one-third of the length of the IR. There were 12 such repeats. Figure 1 shows the configurations for all 46-bp IRs on chromosome III with up to 10% mismatches. There is a noticeable tendency for those repeats to exhibit conserved symmetry even if mismatched.
The search for perfect IRs with GTGAC was repeated for the X chromosome. Only six were found, two of 26 bp, one of 30 bp, and three of 46 bp. The nearest downstream genes were of unknown identity except for a collagen gene (GenBank PID 3874534) and a glycogenin (PID 3879754). All of the 46-bp repeats on the X chromosome were identical in sequence to those of the same length on III.
Two other motifs from IRs of 30 bp were examined: TAGGTCA and CTAAAT.
Neither of these has been reported in Caenorhabditis. TAGGTCA
is a motif of RZR (retinoid-related orphan receptors)(Carlberg et al.,
1994
). Furthermore, a sequence for estrogen response element (ERE)
GGTCA and its inverted complement TGACC are found within TAGGTCA and
its inverted complement TGACCTA (Krawczyk et al. 1993
). The TAGGTCA
motif was searched for all perfect, loopless IRs of lengths 25-60 bp
on chromosome III and found exclusively in those of length 30 bp. We
found TAGGTCA present in two copies of a 30-bp IR upstream of a gene
for 5 estradiol 17 beta hydrogenase 3.
CTAAAT is a motif involved in regulation of iron metabolism in
Pseudomonas (Rombel et al. 1995
). The motif CTAAAT, initially found on chromosome III in three 30-bp IRs, was also searched within
perfect, loopless repeats of 25-60 bp and was found only at lengths 25 (one copy), 28 (three copies), and 38 (two copies). Genes associated
with this motif (with their GenBank PID numbers) were P59 protein
(861,392), cox-17 (3,790,743), protein phosphatase (849,241) and
nucleolus-cytoplasm shuttle phosphoprotein (669,020), as well as four
genes of unknown function.
These searches for IRs with TAGGTCA and CTAAAT were repeated for the X chromosome. Remarkably, there were no IRs either perfect or imperfect with those motifs, with one exception: two imperfects of size 25 contained TAGGTCA, both associated with genes of unknown functions.
GTGAC and TAGGTCA Are in Several Repeats Associated with hsp104
Interest in the GTGAC and TAGGTCA motifs led us to the discovery of eight IRs in the promoter region of a gene for hsp104 (PID # 3979898)(Fig. 2). The eight repeats are clustered in five regions, the first two of which are IRs of 54 bp each. The third region contains two overlapping 54-bp IRs. The overlap area is a 14-bp IR. The fourth region has three overlapping IRs, two of 54 bp and one of 66 bp, with another 14-bp repeat in an overlap region. The fifth region is a 50-bp IR (Fig. 2a,b). All eight repeats are conserved in respect to sequence and shape. All but the 50-bp repeat include GTGAC and two TAGGTCAs as direct repeats (Fig. 2); the 50-bp repeat contains just one each of the two motifs. Furthermore, the background sequence in this area is full of other GTGACs and TAGGTCAs, as well as irregular IRs with >10% mismatches and therefore below the resolution limit for this search.
|
| |
DISCUSSION |
|---|
|
|
|---|
The current wealth of sequence data has been amassed at a much faster rate than the rate at which we can convert it into useful biological information. Multiple independent approaches are needed to organize these data into usable results. The approach we took for this study was to construct a new tool to analyze potential promoters by focusing on certain types of structural symmetries reflected in DNA sequence. A searchable annotated catalog of IRs of Caenorhabditis chromosomes III and X was generated for this study. It continues to be useful as a discovery tool in searches for and analyses of promoters. Both interesting numerical trends and conserved motifs within IRs were found and analyzed.
Odd/Even Bias in Short Perfect Inverted Repeats
Athough there is no simple numerology to gene regulation, and mere
counting will not reveal any complex patterns, there are some
intriguing numerical trends that are worth noting. Just as Chargaff
(1950)
observed that C = G and T = A, simple patterns, in some
cases, have important but as yet unknown biological significance.
This analysis of chromosomes III and X of Caenorhabditis has
revealed, so far, two numerical trends: a bias for odd-length non-AT-rich IRs and a bias for even-length AT-rich IRs. Our discovery tool is set up so that researchers may visit the web site and perhaps
discover other interesting patterns. A bias for odd-length non-AT-rich
IRs between 5 bp and 19 bp has not been reported in the literature. Nor
has the pronounced bias for even-length AT-rich IRs between 20 bp and
60 bp. However, Cox and Mirkin (1997)
, comparing the genomes of several
prokaryotes and eukaryotes (although not Caenorhabditis)
noted that most long IRs were <10% GC content. We also found a
paucity of GC-rich IRs.
In prokaryotes, it has been observed that IRs of 4, 5, and 6 bp are
avoided because they would often comprise restriction sites (Gelfand
and Koonin 1997
). Also Robinson et al. (1995)
found a particular
octameric IR was especially abundant in cyanobacteria. The biases we
are reporting for Caenorhabditis chromosomes III and X,
although they cannot yet be explained, suggest a strong evolutionary
selection that might also exist in other eukaryotic genomes.
Distribution of Inverted Repeats on Chromosomes III and X
Results from this analysis of distribution did not differ markedly
from that of the C. elegans Sequencing Consortium (1998)
, even
though its distribution study included irregular repeats up to 2000 bp,
while our analysis was of all perfect repeats of size 4-30 bp, with an
additional analysis of repeats composed exclusively of A and T. We did
not include longer IRs in the analysis because of their scarcity. The
C. elegans Sequencing Consortium found that IRs were fairly
uniform across the X chromosome, with only a slight bias to the
chromosome arms. The consortium's analysis of chromosome III showed a
more bowl-shaped distribution, with a bias to the arms. We confirmed
these results. In addition, by separating out the data for AT-rich IRs,
we found some pronounced spikes or clusters on the X that are not as
obvious when all of the data are viewed together. This suggests that
the X has denser clusters of AT-rich sequence than chromosome III.
Further analysis of the AT-rich regions was not pursued in this study;
the data are available at our web site.
Genes Putatively Associated with the Functions of G-Proteins and GTGAC
Cascades involving G-proteins are universal throughout the eukaryotes and are used in a wide diversity of situations in which a signal is transferred from a cell surface receptor to the inside of the cell. It is likely that eukaryotic multicellularity was a selection pressure for the fine-tuning of this and other means of cell-cell communication. A typical G-protein cascade begins with the binding of a receptor by a hormone, neurotransmitter, or other factor or by analogous drugs. Binding stimulates the assembly of G-proteins, which in turn initiates the activity of effector molecules, followed by the release of second messengers such as cAMP. The second messengers activate protein kinases specific to threonine and serine, which mediate cell responses, including transcription of genes.
The well-studied ras family of oncoproteins is a family of modified
G-proteins involved in signal transduction cascades sensitive to
mitogens. One of the results of such a cascade may be the activation of
transcription factor AP-1 (activator protein-1, composed of products
of fos and jun). The promoter region to which AP-1 binds often has a
GTGAC motif sometimes within or next to an IR. Weisz and Rosales
(1990)
were first to report GTGAC as part of an imperfect palindrome
capable of binding both estrogen receptor and AP-1 within a promoter
region of c-fos in mammalian cells. Wasylyk et al. (1991)
showed the
same motif in an inverted repeat of the AP-1 binding region
upstream of a gene for matrix degradation in mammals.
The GTGAC motif can also appear upstream of ras genes themselves. For
example, in Drosophila as well as in mammals, the ras promoter region
is bidirectional. The ras promoter of Drosophila is situated between
ras and rop (ras opposite) and regulates both by means of a site that
includes an AP-1 binding region with the GTGAC motif (Lightfoot et al. 1994
).
There has been no previous description of GTGAC motifs in Caenorhabditis. It makes sense that the many components of a specific G-protein-related cascade would be coordinately regulated. Thus, our observations, described below, concerning common motifs in promoters of genes of some G-related proteins may well have regulatory significance.
Table 4 shows all of the perfect, intergenic IRs of 25 bp to 60 bp
containing a GTGAC motif on chromosome III. Such repeats were found
only at lengths 46, 44, 38, 30, 28, 26, and 25 bp. Furthermore, in all
cases of these perfect IRs, GTGAC was positioned to be half of the
pivot point of the palindrome. For each repeat, the immediate upstream
and downstream genes for both direct and indirect strands were noted.
Of the 48 genes (or predicted genes) listed, 21 have no identified
homologies or similarity with known genes. Of the 27 genes that are
meaningfully annotated, seven are tentatively associated with the
functioning of G-proteins. One of these is similar to a family I
G-protein-coupled receptor, three are similar to protein kinases, one
has a tyrosinase domain, one has a probable rab-gap domain, and one has
a domain similar to that of disheveled and egl-1 associated with
G-protein regulation (Elmore et al. 1998
).
Ten IRs with the GTGAC motif are found within genes of chromosome III,
presumably as parts of introns (Table 5). Of these, two may have an
association with G proteins: a protein kinase and a gene with repeats
similar to those of thrombospondin (Frazier et al. 1999
). Therefore,
the total of genes tentatively associated with both G proteins and
GTGAC is at least ten, counting only those genes either immediately up-
or downstream or containing GTGAC.
Irregular IRs of 46 bp (with mismatches up to 10% and loops up to one-third the length) and containing GTGAC were searched. In many cases, the symmetry of the IR is preserved in spite of mismatches (Fig. 1). Furthermore, in many cases, GTGAC preserves its position as half of the pivot point of the palindrome or is maintained as an asymmetrical part of the pivot. Most of the genes associated with these mismatch repeats were of unknown function.
These results suggest the potential usefulness of search algorithms for identifying potential promoter motifs. In particular, the DNA motif GTGAC, especially as part of an IR may be part of a cis-regulatory system for genes associated with the functions of G-proteins. It should be noted, however, that there are at least 14 genes on chromosome III identified at NCBI as possibly coding for G-protein receptors per se and only two of these were found to be associated with GTGAC IRs either up- or downstream, with that motif as half of a perfect 10-bp palindrome. One is upstream of PID 3880235 (Table 4) and the other is upstream of PID 3881443. (Both are GenBank protein ID numbers.) Furthermore, there are 28 genes on the X chromosome identified at as G-protein receptors, none of which were associated with GTGAC motif repeats of the type described in this study.
Other Motifs: TAGGTCA and CTAAAT Associated with Inverted Repeats
Two other published motifs, TAGGTCA and CTAAAT, were present on
chromosome III as parts of perfect IRs. Both examples of TAGGTCA were
within 30-bp repeats, upstream of a gene for 5 estradiol 17 beta
hydrogenase 3. Carlberg et al. (1994)
reported this motif as part of a
retinoid-related orphan receptor that may function as part of a
palindrome or direct repeat and Krawczyk et al. (1993)
describe an
ERE-motif GGTCA, which is reported here as part of TAGGTCA. The
location of the two motifs upstream of 5 estradiol 17 beta hydrogenase
3 may be significant in that 17 beta-estradiol can cause up-regulation
of some genes via ERE (Lee and Mouradian 1999
).
The genes associated with IRs containing CTAAAT do not have obvious
connections; they are the genes for P 59 protein, cox 17, protein
phosphatase, and nucleolus-cytoplasm shuttle phosphoprotein. Rombel et
al. (1995)
reported that motif as part of a consensus G/CCTAAAT-CCC, a
putative transcription-factor-binding site for bacterial iron regulation.
Genes Similar to Yeast hsp104 and yK10 with GTGAC and TAGGTCA Motifs
A search of chromosome III for irregular, 46-bp IRs with both GTGAC
and TAGGTCA motifs turned up eight IRs, all clustered within a single
promoter region flanked by a gene with similarity to yeast gene yK10 on
the 5' side and two yeast hsp104 genes in tandem on the 3'
side. The entire locus looks like a satellite repeat region, possibly
of the type containing heat shock response elements (HSEs), reported to
be significant in the regulation of some hsp genes of yeast, fruit fly
and mammal (Fernandes et al. 1994
; Krawczyk et al. 1993
). Identifying
characteristics of HSEs include EREs TGACC, present here as part of the
IR of TACGGTCA and GAA boxes, and their IRs present in large numbers
throughout the background (LaVolpe et al. 1988
; La Volpe 1994
).
Although it is beyond the purview of this paper to speculate on the cis regulation that might be occurring at this site, it should be noted
that the relationships between these repeats seems to be quite complex.
Some of the repeats overlap, and there are many copies of the various
HSEs in and around the repeats. Furthermore, many similar IRs
containing >10% mismatches can be found in this area (Fig. 2).
However, there are five other hsp genes identified on chromosome III
and six on the X chromosome. None of these have promoter regions with
IRs containing either of the two motifs (within our range of
resolution). Nevertheless, the striking enrichment of IRs with two
motifs in the promoter area of one hsp104 gene is likely to be
significant. HSEs are known to act over long distances (Lewin 2000
),
leaving open a possible influence on other heat shock genes at other loci.
The potentials for the use of IRs are likely to extend much further
than the most obvious palindromic configurations presented here. It
should be considered that a given IR might appear nested within other
repeats, oriented in other ways with respect to other sequences, or
with the two halves separated by thousands of base pairs of other
sequences. It is premature to draw final conclusions about the roles of
IRs or to limit searches to only some types or orientations. The
grammar and syntax of gene regulatory mechanisms in multicellular
eukaryotes are likely to be not only complex but full of redundancies
and irregularities, as in any evolving language. Particular sequences
of IRs should be searched to determine the extent to which they are
also direct repeats, everted repeats, and mirror-image repeats. That
is, although the various categories of repeats have distinct
designations, they are in fact not mutually exclusive. Any sequence by
virtue of its position and orientation may be any one or all of the
types of repeats. Furthermore, the looping of DNA regulatory sites may
alter the effective orientation of a repeat within a transcription
complex. Indeed structure, position, and orientation are more important
than exact sequence in regulatory sites. We see our annotated catalog
as a tool for discovery in silico (Clarke and Berg 1998
) and an
appropriate complement to the genetic analysis of regulation.
| |
METHODS |
|---|
|
|
|---|
A dynamic programming algorithm was used to search for IRs of 40-200 bp (both perfect and imperfect) and 4-60 bp (perfect only) on chromosomes III and X. The algorithm, a longest-common subsequence variant of edit distance, maximizes the number of exact match base pairs. For this study, perfect IRs of even length are symmetrical and contain no mismatches. Perfects of odd length are defined to include a single base pair only at the center of the repeat. IRs (40-200 bp) were reported if at least 90% of the base pairs on the stem matched exactly and if hairpin loops were no larger than one-third the length of the IR. Loops were defined as being comprised of sequences with no possibility of internal base pairing. However, "blebs", mismatched bases in the stem, may include sequences with possible base pairings. In no case is it assumed that any base pairing occurs in vivo. Figures depicting internal base pairing are for the purposes of visualizing the repeats.
The web site http://genomics.wheatoncollege.edu provides tools to search and view the results, including a search engine (Fig. 3) to locate IRs, a utility to draw optimal structures including loops, and a browser (Fig. 4) to allow the user to walk up and down a chromosome and view the relative positions of IRs and genes. In a search, IRs that are AT-rich (defined by us to be comprised exclusively of As and Ts) may be filtered out. Furthermore, all IRs have been unnested such that only unique sequences are reported, not those that are embedded symmetrically within larger sequences. The drawings of genes are linked to GenBank, specifically to the protein descriptions for each of the genes on chromosomes III and X.
|
|
The sequence files for Caenorhabditis chromosome III
(worm_III.fna) and chromosome X (worm_X.fna) were downloaded from the GenBank (NCBI) ftp site (ncbi.nlm.nih.gov) in the directory /genbank/genomes/C_elegans/ (CHR_III, May 24, 1999 and CHR_X, November
7, 1999). Control searches were run for perfect IRs of lengths 4-60 bp
on random input files of the same number of base pairs as worm_III.fna
and worm_X.fna (~11million bp and 16 million bp, respectively) and
with a GC content of 36% as reported by the C. elegans
Sequencing Consortium (1998)
. As the other chromosomal sequences of
Caenorhabditis become more finalized, especially in the
repetitive regions, those also will be searched and added to the web site.
| |
ACKNOWLEDGMENTS |
|---|
The equipment was purchased in part by funds from the National Science Foundation. Additional funding was provided by a Wheaton Foundation grant and a Shouse Fellowship. We thank Richard Durban, Sanger Institute, for e-mail discussions early in this project and Robert Obar, Cereon Genomics, for critical guidance throughout the project.
The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.
| |
FOOTNOTES |
|---|
2 Corresponding author.
E-MAIL BDyer{at}Wheatoncollege.edu; FAX (508) 285-8278.
Article and publication are at www.genome.org/cgi/doi/10.1101/gr.122700.
| |
REFERENCES |
|---|
|
|
|---|
Received October 12, 1999; accepted in revised form July 11, 2000.
This article has been cited by other articles:
![]() |
A. M. Campbell Public Access for Teaching Genomics, Proteomics, and Bioinformatics CBE Life Sci Educ, June 1, 2003; 2(2): 98 - 111. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Dyer and M. D. LeBlanc Meeting Report: Incorporating Genomics Research into Undergraduate Curricula CBE Life Sci Educ, December 1, 2002; 1(4): 101 - 104. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||