|
|
|
|
Vol. 10, Issue 8, 1158-1171, August 2000
LETTER
|
| |
ABSTRACT |
|---|
|
|
|---|
Prior genetic and physical mapping has shown that the Naip gene cluster on mouse chromosome 13D1-D3 contains a gene, Lgn1, that is responsible for determining the permissivity of ex vivo macrophages to Legionella pneumophila replication. We have identified differences in the structure of the Naip array among commonly used inbred mouse strains, although these gross structural differences do not correlate with differences in L. pneumophila permissiveness. A physical map of the region employing clones of the C57BL/6J haplotype confirms that there are fewer copies of Naip in this strain than are in the physical map of the 129 haplotype. We have also refined the genetic location of Lgn1, leaving only Naip2 and Naip5 as candidates for Lgn1. Our genetic map suggests the presence of two hotspots of recombination within the Naip array, indicating that the 3' portion of Naip may be involved in the genomic instability at this locus.
[The sequence data described in this paper have been submitted to the GenBank data library under accession nos. AF240489-AF240530.]
| |
INTRODUCTION |
|---|
|
|
|---|
Genetic variation in the ability of ex vivo mouse
macrophages to support the intracellular replication
of Legionella pneumophila has been mapped to mouse chromosome
13D1-D3 (Lgn1; Beckers et al. 1995
; Dietrich et al. 1995
). The
human region orthologous to the Lgn1 locus on chromosome
5q11.2-q13.3 contains mutations responsible for a family of autosomal
recessive neurodegenerative diseases termed spinal muscular atrophy
(SMA; Gilliam et al. 1990
). Distinct genes present in both intervals
have been attributed to the primary effects of each phenotype. While
one or more closely related Naip (neuronal
apoptosis inhibitory protein)
paralogs has been identified as a candidate gene for Lgn1
(Endrizzi et al. 1999
; Growney et al. 2000
), SMN is responsible for the
majority of SMA cases (Lefebvre et al. 1995
; Rodrigues et al. 1995
).
However, Naip remains a candidate modifying gene for SMA
disease severity (Roy et al. 1995
; Morrison 1996
; Chang et al. 1997
).
Correlation between disease severity and the extent of genomic
deletions has provided additional support for the role of Smn
flanking genes in SMA progression (DiDonato et al. 1994
; Wirth et al.
1995
; Burlet et al. 1996
). Therefore, continued study of the
Naip gene family will likely provide insight into L. pneumophila susceptibility and SMA.
Both the mouse and human Lgn1/SMA intervals contain multiple
copies of large segments of DNA (Carpten et al. 1994
; Burglen et al.
1996
, 1997
; Carter et al. 1997
). We have previously demonstrated that
the structure and number of the repeated segments in these regions is
different in mouse and human, indicating an independent origin for the
genomic amplifications in these species (Growney et al. 2000
). For
example, the SMA locus resides within a large inverted duplication that
includes SERF1, SMN, NAIP, and
GTF2H2, while the mouse Lgn1 region contains a direct
repeat of a variable number of Naip genes. To date,
Naip is the only identified gene common to the amplifications
in both species (Scharf et al. 1996
, 1998
; Schrank et al. 1997
; Viollet
et al. 1997
).
The differences in the structure of the array between mouse and human,
as well as the complexity of the mouse array, suggest that this region
of the genome is subject to various types of rearrangements.
Furthermore, differences in SMN and NAIP gene copy
numbers in human SMA patients (Rajcan-Separovic et al. 1996
) imply that
understanding the mechanisms of genomic instability of these loci may
play a crucial role in predicting SMA outcome. Continued comparative
genomic analysis may identify additional common sequence elements that
will further our understanding of the instability of these regions.
We have previously constructed a detailed physical map of the
Naip gene array in the 129 mouse haplotype (Growney et al.
2000
). This map contains a direct repeat of seven complete
Naip genes with three 5' truncated Naip loci
interspersed within the array. An important character of the 129 structure is that the central portion of the Naip array
contains several copies of Naip genes (known as
Naip3-Naip7 and
Naip1-3),
which are much more highly related to each other than they are to the
Naip genes on the proximal and distal borders (which are known
as Naip1 and Naip2). The central Naip genes
share such extensive homology that copies of microsatellite loci in
their introns are simultaneously amplified by the same pair of primers,
whereas Naip1 and Naip2 contain markers within their
introns that map uniquely in the mouse genome. Based on the marker
content and exon sequence homology of the different Naip
paralogs, we have proposed a model for the origins of the 129 Naip array (Growney et al. 2000
).
Our previous genetic and physical maps of the region have suggested
that one or more copies of Naip are responsible for the Lgn1 phenotype. However, polymorphisms between the strains
used in our genetic mapping (A/J and C57BL/6J) and the strains used in
our physical mapping (129) have prevented us from refining the
Lgn1 genetic interval within the central portions of the
Naip array (Dietrich et al. 1995
; Scharf et al. 1996
; Endrizzi
et al. 1999
; Growney et al. 2000
). Because we have several animals from our cross that are recombinant within the Naip array, it
seemed likely that additional attempts to physically map the location of recombinant genetic markers contained in the central repetitive Naip array would allow us to improve our genetic mapping of
Lgn1.
Our interest in understanding both the mechanisms involved in the
apparent genomic instability of this region and in identifying the
Lgn1 gene have led us to compare the structure of the
Naip array among commonly used inbred mouse strains. Here, we
report significant differences in the structure of the array among
commonly used inbred mouse strains that do not obviously correlate with permissiveness to L. pneumophila replication. We have also
constructed a new physical map of the Lgn1 region using clones
of the C57BL/6J haplotype. Using this physical map to localize the
position of polymorphic but repetitive markers, we have refined the
genetic interval for Lgn1 to the highest resolution possible
with our current backcross (Scharf et al. 1996
). Because we have
identified apparent recombination hotspots within the Naip
array, it is possible that sequences within the 3' portion of
Naip may be responsible for the instability within the
Naip array.
| |
RESULTS |
|---|
|
|
|---|
Comparison of Naip Repeat Structure among Inbred Mouse Strains
The sequence of BAC 149m19 (AF131205; Endrizzi et al. 1999
), BAC
26f17 (AF242431, AF242432), and P1-9045 (AF242433, AF242434, AF242435;
Endrizzi et al. 2000
) together encompass six complete Naip
genes. These include the "unique" Naip genes on the
borders, Naip2 and Naip1, as well as four of the five
Naip genes that lie in the central amplification, namely
Naip5, Naip7, Naip6, and Naip3
(Fig. 1; Growney et al. 2000
). Our analysis of these
genomic sequences indicates that intron 13, which is present in all
copies of Naip, exhibits gene-specific polymorphisms and can
be grouped into two classes. We call one group "type I" loci, present in Naip2, Naip5, Naip3,
Naip, and Naip1, and which are 337, 304, 318, 318, and 289 bp, respectively. We call the second group "type II" loci,
present in Naip7 and Naip6. Type II loci are 6,545 bp
due to an insertion of an L1 repeat unit (Endrizzi et al. 2000
).
|
The presence of these polymorphisms led us to use intron 13 as a marker
for comparison of the structure of the Naip array among inbred
mouse strains. To do this, we devised a PCR assay, D13Die31, which
amplifies all type I intron 13 loci and two PCR assays, D13Die32 and
D13Die33, which amplify the proximal and distal ends of the type II
intron 13 (Table 1). As expected, D13Die31 yields
four bands from a panel of 129 BAC and P1 clones spanning the entire
Lgn1 interval (Fig. 1A). Three of these bands were unique to
specific Naip loci. Notably, band A maps to Naip2, band C maps to Naip5, and band D maps to Naip1. Band
B, on the other hand, is present in multiple nonoverlapping clones,
mapping them to multiple loci, including Naip3 and the three
Naip loci. This finding is in agreement with our previous
prediction that the
Naip loci are closely related to
Naip3 (Growney et al. 2000
). We also found that D13Die32 (Fig.
1B) and D13Die33 (data not shown) are present in multiple copies
throughout the map, mapping intron 13 type II to Naip6,
Naip4, and Naip7. The positions of these markers
within the Naip array from the 129 haplotype are indicated in
Figure 1C.
|
We took several approaches to investigate whether the structure of the
Naip array in strains C57BL/6J and A/J, which are the parents
of the cross we used to map Lgn1, was the same as that observed in the 129 haplotype. First, we found that the intron 13 type
I marker D13Die31 yields an identical pattern of bands when amplified
on genomic DNA from the A/J, C57BL/6J and 129 strains, suggesting that
all the basic elements of the Naip array are present in these
strains (Fig. 1D). Second, we analyzed genomic DNA with microsatellite
markers that map to the central portion of the Naip array
(Growney et al. 2000
). As can be seen in Figure 2, the number of polymorphic bands amplified by D13Die7 and D13Die25 varies between mouse strains, with 129 strains consistently yielding more bands than A/J and C57BL/6J.
|
Because this data suggests the possibility that inbred mouse strains
differ in the number of Naip gene subunits contained within
the central repeat, we performed hybridization experiments in an
attempt to compare the total number of Naip genes in different mouse strains. We observed significant differences in the hybridization pattern of a Naip exon 11 probe to BamHI genomic Southern
Blots (Fig. 3). We have previously mapped ten
Naip exon 11 loci in mice of the 129 haplotype (Growney et al.
2000
). Consistent with differences in the number of copies of
repetitive microsatellite markers, the A/J and C57BL/6J strains
demonstrate hybridization patterns distinct from 129 strains and
consistent with differences in the number of copies of repetitive
microsatellite markers. Notably, these strains lack the Naip4
specific 5-kb band. In addition, the 3.5-kb triplet band, mapping to
Naip3, Naip6, and Naip7, and the 2.5-kb
fragment mapping to the three
Naip loci are consistently less intense in A/J and C57BL/6J. Together, these data suggest that the
central amplification within the Naip array is larger in 129 strains than in A/J and C57BL/6J.
|
Construction of C57BL/6J Physical Map
To determine the structure of the Naip array in C57BL/6J,
we constructed a physical map of the region using clones derived from
this strain. We identified 21 clones from two distinct BAC libraries
(see Methods; Table 2). We ordered the clones into a
complete physical map of the C57BL/6J Naip array using markers developed in mapping the 129 interval (Table 1) (Dietrich et al. 1994
,
1995
, 1996
; Scharf et al. 1996
, 1998
; Endrizzi et al. 1999
; Growney et
al. 2000
). Our reasoning behind our ability to order the clones and
markers is outlined as follows. First, all clones were typed for the
presence of single-copy markers. These include D13Die3, D13Die6,
D13Die24, D13Die26, D13Die27, D13Die37, and Ocln (data not
shown, Table 1). These markers identified clones that contain
single-copy sequence on the proximal and distal borders of the region.
Second, clones containing Naip2, Naip5, and
Naip1 were identified by D13Die31 loci A, C, and D (Fig.
4A). In addition, clones that extend into the repeat
were identified by the presence of D13Die31-B.
|
|
Finally, those clones that extend into the central Naip repeat
were ordered by typing microsatellite markers D13Die7 (Fig. 4B),
D13Die25 (Fig. 4C), D13Die35 (Fig. 4D), and D13Die36 (Fig. 4E). For
each marker, two distinct loci were amplified from genomic DNA. At
least one clone was identified for all markers that contains only one
locus of each repeat marker, allowing duplicated loci to be ordered
relative to each other. For example, clones 434i9 and 235 each contain
a single copy of D13Die25, band B (for nomenclature, see Methods). Both
clones contain the single-copy marker D13Die27 (data not shown),
indicating that D13Die25-B maps on the proximal side of the repeat.
Clone 367k11 contains only one copy of D13Die25, band D. This clone
also contains the distal single-copy marker D13Die3, placing D13Die25-D
distal to D13Die25-B. While we were able to order both loci amplified
with a given marker relative to each other, the order of distinct
markers in two regions of the map was ambiguous from the marker content
of the clones. The first region, located in the interval from
Naip5 to
Naip, includes D13Die35-B, D13Die25-B,
D13Die7-B, and D13Die36-A. The second region, within Naip6,
includes D13Die35-A and D13Die25-D. Because these markers have been
previously mapped to specific intronic or intergenic regions, they were
ordered relative to each other based on our prior knowledge of genomic
sequence (Endrizzi et al. 1999
, 2000
).
These data allowed us to order all the clones into a contiguous map of
the Naip region. Additional Naip sequence content was identified by Southern blot analysis. We probed each clone for the
presence of Naip exon 3 (Fig. 5A) and
Naip exon 11 (Fig. 5B). We were able to map six copies of
Naip exon 11 and five copies of Naip exon 3. Specific
Naip loci were identified based on the relative position of
restriction fragments within the contig (proximity to single-copy
markers) and comparison of restriction fragments to Southern blot
analysis of 129 BACs (data not shown) (Growney et al. 2000
). Consistent
with the identification of six Naip exon 11 loci and five
Naip exon 3 loci, only a single locus for D13Die30, a marker
for the junction of a complete Naip gene and a 5'
truncated Naip locus, and intron 13 type II (D13Die32 and
D13Die33) was identified (data not shown). Finally, the end sequence of
all clones in our map were compared to the sequenced 129 clones BAC 149m19 (AF131205), BAC 26f17 (AF242431, AF242432), and P1 9045 (AF242433, AF242434, AF242435) and the strain B10.A-derived
Naip cDNA clones (Huang et al. 1999
; Table 2). The positions
of all clone ends within the map are consistent with the marker content
of each clone.
|
Taken together, this data identifies six Naip loci in
C57BL/6J. Beginning at the proximal edge of the array, these loci are Naip2, Naip5,
Naip, Naip6,
Naip3, and Naip1 (Fig. 6). We are also now able to definitively map all known Naip cDNAs to
specific Naip loci (Table 3). Our completed
map, together with our completed genomic sequence of the proximal and
distal aspects of the Naip array, enables us to estimate the
size of the Naip array in the C57BL/6J haplotype from
Naip2 to Naip1 to be 313 kb, while it is ca. 471 kb
in strains of the 129 lineage because of the presence of two additional
79-kb repeat subunits, each containing one complete Naip gene
and one
Naip locus.
|
|
Improved Genetic Mapping of Lgn1
Our genomic mapping data (Figs. 1, 2, 3; unpublished observations) demonstrate that a permissive strain (A/J) and a nonpermissive strain (C57BL/6J) have similar gene arrangements and copy numbers within the Naip array. This indicates that differences in Naip gene copy number are not responsible for the Lgn1 phenotypic differences observed in our A/J and C57BL/6J cross. Therefore, the Lgn1 mutation is unlikely to result from a gross alteration of the structure of the Naip array, at least for these two strains. This suggests that it should be possible to narrow the genetic interval of Lgn1 to a small subset of genes.
We previously reported a 466 animal backcross ([A/J × C57BL/6J] × A/J), which was used to map Lgn1 to chromosome 13 (Dietrich et
al. 1995
; Scharf et al. 1996
). Five animals from this backcross are
recombinant across the remaining Lgn1 interval (between
D13Die26 and D13Die3). Therefore, we used our completed map of the
C57BL/6J Naip array to finely map the recombination
breakpoints in these animals relative to the position of the genes in
the interval.
We previously isolated several markers from the central Naip
array (e.g., D13Die7) that amplify one or more loci that recombine on
the distal side of Lgn1. However, up to this point, we have not been able precisely to precisely physically map these recombinant loci relative to the genes in the Naip array (Scharf et al.
1996
; Endrizzi et al. 1999
; Growney et al. 2000
). The C57BL/6J map
allowed us to physically localize each recombinant locus in the
Naip array. In particular, analysis of D13Die30 for
single-nucleotide polymorphisms allowed us to very narrowly define the
Lgn1 critical interval (Fig. 7). This new
critical interval only contains the Naip2, Naip5, and
3' portion of
Naip genes. In addition, our genetic and
physical map analysis allowed us to define two small regions within the
Lgn1 interval that contain all five recombination events from
our cross. The recombination event for three animals occurs within a
17.1-kb interval flanked by D13Die26 and D13Die37, located within
Naip2, spanning exons 9-12. The breakpoint for the remaining two recombinant animals lies within a 17.7-kb interval between D13Die30
and D13Die36-A, located within
Naip, spanning exons 7-14.
Further refinement of the recombination break points will not exclude
additional Naip loci from the Lgn1 critical interval with our current 466 animal backcross.
|
DISCUSSION
The Lgn1/SMA region of the mouse and human genomes
continues to be a rich locus for comparative genomic studies. Previous comparative genomic mapping of this region has identified differences in the structure of the amplified segments present in the mouse and
human genomes. Specifically, the human SMA disease interval on
chromosome 5 in most individuals contains a large (~500 kb) inverted
duplication with each subunit of the duplication containing at least
one copy of SMN, NAIP, GTF2H2 (previously
known as BTF2P44), and SERF1 (previously known as
H4F5; Melki et al. 1994
; Roy et al. 1995
; Lefebvre et al.
1995
; Burglen et al. 1997
; Carter et al. 1997
; Scharf et al. 1998
,
Growney et al. 2000
). The mouse genome, however, contains only a single
copy of Smn, Serf1, and Gtf2h2 (Scharf et
al. 1996
; Viollet et al. 1997
; Schrank et al. 1997
; Bergin et al. 1997
;
DiDonato et al. 1997
, 1999
). In contrast to human, the mouse
Lgn1 interval contains a direct repeat of six to ten complete
and partial copies of Naip (Scharf et al. 1996
; Huang et al.
1999
). While the differences in structure have so far precluded the
identification of common unstable elements, such studies have been
useful for identifying candidate phenotypic modifying genes for SMA
(Scharf et al. 1998
). Here, our comparative genomic analysis has
allowed us to identify significant differences in the structure of the
Naip array among commonly used inbred mouse strains and to
refine the Lgn1 genetic interval.
Our studies of the Naip array employing microsatellite marker
analysis and hybridization studies suggest that several features of the
Naip array are conserved among inbred mouse strains (Fig 8). Notably, Naip2 and Naip1 form
the proximal and distal aspects of the array, respectively. These loci
flank a centrally located repeat of more closely related Naip
loci. Naip5 and a
Naip form the proximal side of
the repeat, while Naip6 and Naip3 form the distal end
of the repeat. However, 129 strains contain four additional Naip loci, namely
Naip1, Naip7,
Naip2,
and Naip4 between Naip5 and
Naip3. In
Figure 8, we have indicated that Naip7, Naip4, and
two
Naip loci have been inserted between Naip5 and
the single
Naip locus present in the C57BL/6J genome.
However, our designation of Naip6 in the C57BL/6J haplotype is
arbitrary and is done to simplify nomenclature of genes and marker
loci. The insertions resulting in the current Naip array
within the 129 haplotype may have occurred on the proximal side of what
we have designated Naip6 in the C57BL/6J haplotype or in any
position between Naip3 and Naip5 (Fig. 8). Future
genomic sequencing of Naip6 from C57BL/6J may determine if it
is more closely related to Naip7, Naip4, or Naip6 in the 129 haplotype.
|
Our complete map allows us to definitively identify the
transcriptionally active Naip loci and correlate them with
previously identified Naip cDNAs. We have not identified any
cDNAs mapping to the Naip3 locus, which genomic sequencing
suggests is likely to be nonfunctional (Endrizzi et al. 2000
). Thus, we
have mapped all identified Naip cDNAs to four loci (Table 3;
Yaraghi et al. 1998
, 1999
; Huang et al. 1999
). Our cDNA clones indicate
that Naip6 transcription extends through
Naip
exons 7 and 8 and then is polyadenylated. For that reason, the
Naip locus likely does not encode a functional transcript.
While the Naip6 locus has been shown to be transcriptionally
active, no information concerning the transcription of Naip7
or Naip4 in the 129 haplotype is available. It is interesting
to speculate that amplification of the Naip6 locus may
indicate a selection for specific functions of this Naip locus.
A principal goal in mapping this region was to identify the physical
location of mapped polymorphic markers from the interval to improve the
resolution of our genetic mapping of Lgn1. As a result of our
work, the current critical region for Lgn1 has been shortened
to the interval from D13Die26 to D13Die30. This critical region
includes Naip2, Naip5, and the 3' portion of
Naip. Because
Naip is unlikely to be
functional, Naip2 and Naip5 are the remaining candidates for Lgn1. This is further supported by our findings that mouse strains 129S3 and 129P3, which contain additional copies of
Naip6 and
Naip, are permissive for Legionella
pneumophila replication, while F1 progeny of these strains with
C57BL/6J are nonpermissive (data not shown).
It is difficult to speculate about which of the two remaining candidate
genes is the most likely to contain the Lgn1 mutation. Both
Naip2 and Naip5 are expressed in macrophages (Huang
et al. 1999
). Because so little is known about the molecular function of the Naip proteins, even the presence of considerable
variation in the amino acid sequences of the different Naip
products do not allow for confident predictions of which gene will
encode the unique function implicated by the genetics.
Recent studies provide a preliminary analysis of the expression
profiles of the various Naips. Consistent with our exclusion of Naip1 from the Lgn1 critical interval,
Naip1 has been shown to be more highly expressed in the brain
than in the macrophage-rich spleen (Yaraghi et al. 1999
). Furthermore,
Naip1 has been shown to play a role in hippocampus cell
survival following limbic seizures (Holcik et al. 2000
). However,
Naip1 expression is not limited to the brain, as transcripts
corresponding to this locus have been identified from a macrophage cDNA
library (Huang et al. 1999
). In contrast, Naip2 has been shown
to be highly expressed in spleen and bone marrow macrophages (Huang et
al. 1999
; Yaraghi et al. 1999
). While cDNA cloning suggests that
Naip2 is likely the most strongly expressed Naip
locus in macrophages, data for the expression of Naip5 is not
currently available.
Differences in the relative expression of Naip between A/J-
(permissive) and C57BL/6J- (nonpermissive) derived peritoneal macrophages have recently been identified (Diez et al. 2000
). C57BL/6J-derived macrophages expressed stronger levels of Naip than A/J-derived macrophages, suggesting differences in transcription or mRNA stability as a possible cause of the Lgn1 phenotype.
However, the levels of Naip increased in both strains in response to
L. pneumophila infection. Furthermore, this upregulation of
Naip expression was not specific to L. pneumophila infection,
as infection with Salmonella typhimurium and feeding with
latex beads also induced this response. Unfortunately, these studies
were performed with probes that do not distinguish between specific
Naip loci, making it impossible to tell if the upregulation is
from Naip2, Naip5, or some other Naip gene
unrelated to the Lgn1 phenotype. Our complete physical map and
precise mapping of Naip cDNAs will allow us to generate probes
likely to be specific for individual Naip loci. These studies
are currently underway in our laboratory.
Our data identify the 3' portion of Naip as a variable
region of this gene family that may contribute to the instability of the Naip array. Interestingly, analysis of recombinant animals in our ([A/J × C57BL/6J] × A/J) backcross employed to map
Lgn1 has identified two recombination hotspots within the
Naip array. Of five animals with recombination events within
the Naip interval, three recombination events occur within
17.1-kb interval between D13Die26 and D13Die37 in Naip2, while
the remaining recombinations take place within a 17.7-kb interval
between D13Die30 and D13Die36-A in
Naip. Both intervals map
to the 3' portion of Naip genes. While we have not
identified any particular sequence elements in these regions that
suggest a mechanism for the high frequency of recombination in these
intervals, several interesting observations can be made. First, this
position correlates with the likely position of an ancient
amplification that may have given rise to Naip5 and
Naip, as well as a potential breakpoint for recombination resulting in the more recent expansion of the array in the 129 haplotype. This suggests misalignment of homologous sequences, for
example, between Naip3 on one strand and
Naip on
the other, followed by subsequent unequal recombination as a possible
mechanism resulting in the expansion of the array. Second, the BIR
domains are encoded by Naip exons 3-9, suggesting that these
hotspots also correspond to the position within Naip where it
diverges from other members of the IAP family of proteins (Huang et al. 1999
). Third, the junction between the conserved BIR domains and the
divergent carboxyl terminus of Naip appears to be a variable region within this family of proteins. Specifically, Naip exon 10 is absent from Naip3 and the
Naips, while
Naip2, Naip3, and
Naip contain a unique
150-bp extension at the 5' end of exon 11. Finally, the
identification of a human NAIP cDNA containing portions of
OCLN within the 3' UTR suggest a genomic deletion within
the 3' end of NAIP resulting in the fusion of
NAIP and OCLN. These observations suggest that the
3' portion of NAIP may play a role in the genomic
instability resulting in the generation of SMA alleles in humans.
Our mapping studies that identify Naip2 and Naip5 as the remaining Lgn1 candidate genes suggest several future lines of study. Continued comparative genomics likely will entail sequencing of the Lgn1 critical interval from A/J and C57BL/6J to identify candidate mutations. While several C57BL/6J-derived BAC clones identified in this study will facilitate analysis of this haplotype, our detailed physical maps of the region will enable a PCR-based sequence analysis of the Lgn1 critical interval in the A/J haplotype, for which no genomic clones are currently available.
Assuming that the permissiveness of A/J strains to L. pneumophila replication is not due to a haploinsufficient function
that is lacking in the C57BL/6J haplotype, functional complementation of the permissive phenotype using genomic (this article) or cDNA (Huang
et al. 1999
) clones that we have identified remains a tantalizing possibility. However, these approaches have proven technically challenging because of the difficulty of using A/J as a background for
transgenic embryos and because of the refractory nature of myeloid
cells to transfection (data not shown; Chisholm and Symonds 1988
;
Rupprecht and Coleman 1991
; Wright and Farber 1991
; Stacey et al. 1993
;
Nicolet and Paulnock 1994
). The use of a substitute permissive
transgenic background or the use of viral vectors may facilitate future
analysis of Naip2 and Naip5 by functional
complementation (Strair et al. 1990
; Haddada et al. 1993
).
| |
METHODS |
|---|
|
|
|---|
BAC/P1 Clones
All of the 129-haplotype-derived BAC and P1 clones have been
previously described (Diez et al. 1997
; Yaraghi et al. 1998
; Growney et
al. 2000
). C57BL/6J clones derive from two BAC libraries. Clones 24907 and 235 were identified by Genome Systems. Briefly, library pools were
screened by PCR with primers for Naip exon 3. Candidate clones
were confirmed by PCR and Southern blot analysis. All remaining
C57BL/6J BAC clones derive from the RPCI-23 C57BL/6J BAC library
(http://bacpac.med.buffalo.edu). Briefly, six high-density filter
arrays were screened by Southern blot analysis with a Naip exon 11 (D13Die34) probe as per the manufacturer's instructions. Twenty-five candidate clones were identified and confirmed by PCR with
D13Die34. Nineteen positive clones were chosen for further study (Table 2).
Markers Used in This Study
Primers used in PCR assays to amplify all STSs
(sequence tagged sites) in this
study are indicated in Table 1. Novel PCR assays were developed as
follows. First, STS D13Die31 was developed to amplify all intron 13 loci type I. Primers were chosen to reside in conserved regions of
Naip exons 13 and 14 based on the sequence of BAC 149m19
(accession AF131205), BAC 26f17 (accession AF242431 and AF242432), and
P1 9045 (accession AF242433, AF242434, and AF242435; Endrizzi et al.
1999
, 2000
). D13Die32 and D13Die33 were devised to amplify the distal
and proximal borders of Naip intron 13 type II, based on the
sequence of BAC 26f17.
Second, microsatellite markers D13Die35, D13Die36, and D13Die37 were designed to amplify novel microsatellites identified from the sequence of BACs 149m19 (AF131205) and 26f17 (AF242431, AF242432).
Third, STSs D13Die38-D13Die46 were developed from the end sequence of selected C57BL/6J BAC clones that were not homologous to any sequence in 149m19 (AF131205) or 26f17 (AF242431, AF242432).
Finally, for D13Die30.2, novel primers that flank and encompass locus D13Die30 were developed to improve amplification of this locus.
PCR
Except where noted, all STSs were amplified as previously described
(Growney et al. 2000
). All amplifications were performed in an MJ
Research thermal cycler (PTC-225). Amplifications of BAC clones
employed 5µL of a bacterial suspension. Amplifications of genomic
DNA employed 5-25 ng of DNA. Primers for microsatellite markers were
end labeled with (
32P)-ATP, 6000 Ci/mmol (NEN), and PCR
products amplified as previously described (Dietrich et al. 1992
).
Amplification products were resolved on 6% denaturing polyacrylamide
gel (National Diagnostics) at 120 W for 2-3 hr.
D13Die30.2 was amplified using Expand Long Template PCR System (Boehringer, Mannheim). Briefly, 25 ng of genomic DNA was amplified in a 50-µL reaction containing 300 nM each of forward and reverse primer, 350 µM dNTPs in 1× buffer system 1. Reactions were heated to 94°C for 2 min and cooled to 88°C before 0.75 µL of Expand enzyme mix was added. After addition of enzyme, 10 cycles of 94°C for 10 s, 65°C for 30 s, and 68°C for 10 min was performed, followed by 20 cycles of 94°C for 10 s, 65°C for 30 s, and 68°C for 10 min + 20 s/cycle. A final extension at 68°C for 7 min was performed. PCR products were resolved in a 1% SeaPlaque agarose (FMC) gel and purified using QIAquick Gel Extraction Kit (Qiagen), following the manufacturer's directions.
Genomic DNAs
Mouse genomic DNAs for A/J (stock number JR0646), C57BL/6J
(JR0664), and 129 strains (as previously described) were obtained from
Jackson Labs (Growney et al. 2000
). Where applicable, revised strain
nomenclature is presented (Festing et al. 1999
). Genomic DNA for ES
cell line CJ7 was a gift from E-Chiang Lee (Mammalian Genetics
Laboratory, NCI-FCRDC, Fort Detrick, Frederick, Md.).
Genomic DNA from animals in our backcross was prepared using a
high-molecular weight DNA prep method (Strauss 1998
). Briefly, 10 mL
of ice-cold PBS was added to one-quarter of a frozen (
80°C) mouse liver in a 50-mL conical tube. Tissue was homogenized for 20 s
with a Polytron (PT 1200) tissue homogenizer (Kinematica AG) on setting
5. Homogenates were centrifuged at 1,000 rpm at 4°C for 10 min in a
Beckman GS-6KR rotor. The supernatant was aspirated, and the nuclear
pellet was resuspended in 4.5 mL of ice-cold STE (10 mM Tris-Cl pH 7.5 : 10 mM NaCl : 1 mM EDTA). To each sample, 25 µL of 20 mg/ml
proteinase K, 25 µL of 10 mg/mL RNAse A, and 125 µL 10% SDS
was added. Samples were incubated at 50°C for 15 hr, followed by two
extractions with phenol : chloroform : isoamyl alcohol (25 : 24 : 1;
Boehringer Mannheim). The aqueous phase was dialyzed against TE pH 8.0 at 4°C with two buffer changes over 24 hr.
BAC DNA for Southern blot analysis was prepared by a modified PEG prep
method as previously described (Growney et al. 2000
). BAC DNA for
Pulsed Field Gel mapping was prepared using the Large-Construct Kit
(Qiagen) as per the manufacturer's directions.
Pulsed Field Gel Mapping
150 ng of BAC DNA was digested overnight with NotI. Fragments were resolved in 1% LE agarose (FMC)/0.5 × TBE at 4°C with a BioRad Chef Mapper. Samples were run into the gel using the following Chef Mapper settings: forward gradient = 6.0 V/cm (180° FIGE), initial switch time = 20 min, final switch time = 20 min, reverse gradient = 0, initial switch time = 20 min, final switch time = 20 min, total run time = 20 min, ramp = linear. Fragments 3-100 kb were resolved with the following settings: run time = 15 hr 16 min, voltage gradient = 6.0 V/cm (two state), initial switch time = 0.22 s, final switch time = 8.53 s, angle = 120°, ramp = linear. Fragments 72-250 kb were resolved with the following settings. Run time = 30 hr 4 min; voltage gradient = 6.0 V/cm (two state); initial switch time = 9.29 s; final switch time = 21.79 s, angle = 120°, ramp = linear.
Sequencing
PCR Products
Purified D13Die30.2 PCR products were sequenced with ABI dye terminator chemistry (ABI prism DNA sequencing kit, PE Applied BioSystems). We sequenced 1,479 bp of the 2,904 bp D13Die30.2 PCR product corresponding to D13Die30 from A/J and C57BL/6J DNA with five primers, D13Die30-F, D13Die30-R, D13Die30-seq2 (GCTGGACACTAAAGGCACTATG), D13Die30-seq3 (GCGAAGAAGCTGTCGTTG), and D13Die30-seq4 (CATGCATGCATGTGCAAG). We amplified 290 ng of purified DNA in a 20 µL reaction containing 4 µL Big Dye, 20 pM primer and 2 µL 5× CSA SEQ Buffer (Perkin Elmer). Products were amplified with 25 cycles of 96°C for 10 s, 50°C for 5 s, and 60°C for 4 min. Reactions were resolved on a Perkin Elmer 3700 Capillary Sequencer. Sequences were imported into Sequencher (Gene Codes) for analysis.BAC Ends
The SP6 and T7 ends of purified BAC DNA were sequenced using ABI dye terminator chemistry (ABI prism DNA sequencing kit, PE Applied BioSystems). 1-2 µg of PEG prep BAC DNA was amplified in a 40-µL reaction containing 20 pM SP6 or T7 primer, 8 µL Big dye, and 4 µL 5× CSA SEQ Buffer (Perkin Elmer). Following an initial denaturation at 95°C for 5 min, products were amplified with 50 cycles of 95°C for 30 s, 55°C for 20 s, and 60°C for 4 min. The entire reaction was loaded onto a Perkin Elmer 377 slab gel sequencer.Southern Blotting
Naip exon 3 and exon 11 probes were as previously
described (Growney et al. 2000
). An STS for Smn exon 4-intron
4 was amplified from A/J genomic DNA and labeled as described.
Genomic Blots
In a 0.7 % SeaKem LE agarose (FMC) gel, 10 µg of total genomic DNA (Jackson Labs) was resolved after having been digested overnight with BamHI (NEB). DNAs were transferred to Gene Screen Plus hybridization membrane (NEN) and hybridized with 1 × 106-cpm probe/mL overnight at 68°C in Church's Buffer (Church and Gilbert 1984BAC Blots
In 0.7% SeaKem LE (FMC) agarose gel, fragments of 5 µg of BAC DNA that had been digested overnight with EcoRI or BamHI (NEB) were resolved for 20 hours at 1.2 volts/cm. Blots were performed as previously described (Growney et al. 2000Nomenclature
Repetitive microsatellite loci within the Naip array were
originally named based on the size of PCR products, from largest to
smallest, as amplified from 129 genomic DNA (Growney et al. 2000
).
C57BL/6J loci names correlate to 129 loci based on the finding that
Naip7 and Naip4 are not present in this haplotype (see Results). For example, Naip5 in the physical maps for
C57BL/6J and 129 presented here and elsewhere contains D13Die25-B and
is flanked by D13Die7-B, while Naip6 in both strains contains
D13Die25-D and is flanked by D13Die7-A. Exceptions include markers
D13Die35 and D13Die36, which have not been tested in 129 strains and
are thus labeled by size in C57BL/6J.
| |
ACKNOWLEDGMENTS |
|---|
We thank Matthew Endrizzi and Vey Hadinoto for technical assistance with sequencing described in this work. We thank Victor Boyartchuk and James Watters for critical reading of this manuscript. This work was partially supported by a grant to W.F.D. from the Muscular Dystrophy Association. W.F.D. is an assistant investigator at Howard Hughes Medical Institute.
The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.
| |
FOOTNOTES |
|---|
3 Corresponding author.
E-MAIL dietrich{at}rascal.med.harvard.edu; FAX (617)432-3993.
| |
REFERENCES |
|---|
|
|
|---|